Canis_familiaris Locus Poly:24:SNORD25
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:24:SNORD25
Canis_familiaris
Poly:24:SNORD25
18
SNORD25, SNORD26, SNORD27, SNORD28, SNORD22, SNORD29, SNORD30, SNORD31, SNORD22
1001..1068, 1467..1542, 1827..1901, 2246..2320, 2820..2946, 3163..3229, 3403..3472, 3740..3808, 4039..4163
5163
GGATCGAATCCCACGTCGGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCT
CTGCCTCTCTGTCTCTCTCTGTGTGGCTATCATGAATAAATAAAATCTTTAAAAATTAAA
AATTAAAAAAAAAAAGTAACCAATTCCTGTAGTGTGCTTAAAATAGCGCTTCCAAAATTA
GCGAATATTAGCCCAATTCCCAGCGACAGCGGACCAGACAGTAGGTCCTAGATGGCCGCT
CAGGAAAAATCAGAACCTGTCAGAAAAGCGGAGCACTGACGGCCAGATTCACTTCCAGGC
AAGGGACCCCCCACCCCCACCCCCTAAGGACCCCGCGCACCAGGCTAGGCGGCGGCCATG
GAACCCAGATGACACCAGTCCAGGATTCGGGAGGTGCGGGATCCGCGGAGGCCGCACACT
GGTTTAGGGTGTGTGTGGGTAAGGGGGGTGCTCAGGGCAGGGTGCCGGGACAGGCAGCCG
TGACCGAGGCAGGGTCCGTGCGAAGCCTCCGCCCTTCAGTCCCAGGGGAAGCCGGGTACC
AACCTCCCAGGAGAAGACCAGACCGCCCGCGCGCTTCCCTAAGGCGCATGCGCACCTTTT
TCGCGCCCCAGCTCCAGGCGGGGCTCACTGAACTCCCGCCTTCCCAGGAATTCTCTACCC
ACAATCCCCCGGGTTCGCGCGCCCTCTCCTTATGCGCCTGCGTCGCCATAGTCCCGCCTG
CCCCATCCCGTGGGCCCTTGCGAGGTGGTATTTAAGTGTCTCGCTGCGGTCCTTCGGCCT
CATTTTTCCATGGCAATTGGTAAGCTTCGTTTTTGCTTTATGTTTTTTTTAAGTGACTTG
AGCAGAAAAACTGGGTGAGCGTAGGATGCCTGAGCACTTTCAGTTTCACTCATTGATGGG
CGAGGGAGGGATGAGAGATCTCGGCCGTGGCCTCGATTGCAGGGAGCCGCGGCGGAGCTT
TGCGGAGCACAAAATGGCGGTGGCGGGCCGCACAGGAGGCCCTCTCTGTGATGAGAACCT
TTCACAGACCTGTACTGATCTCCGTGAGGATAAAAAAAACTCTGAGGAGGGCAGCCCGGG
TGGCTCAGCAAGGTTTAGCGCCGCGTTCGGCCCAGGGCGTGATCCTGGAGACCCGGGATC
GAGTCCCACGTCGGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGTCT
CTCTCTCTGTGTCTCTCATGAATACATAAATAAAATCTTAAAAATCGGAGACGGGCCTTG
GCACAGCCGGAGTCCGACACCGTCGTAGCTCCGGAAAACAAAGCGCTTGTGAAATGAACG
GCTGTTGATTTAATATTCTTTGGTCTGCAGGTTCCAGGCGCGCTTGGGAACGCCGAAGAA
TGGAAAAGAACCGACTTGCTAGAGTAAGTGTGACAAGCTTTACCGCGTTCCTCTGTTGTA
GGGTTCAGAGAAGTCCCGTGGGATGTGCTACGGGGATGATACTAGGAATTGAACTCTCTC
TTTCTGATGGGTTGGTGGAGAAAATGTAAAGATTCTGAGTAGCACCATTCCGCAGCAAAC
GTTTGCGTTTTTAGCGCGGACTTCTAGGAACGAACATGAGACAGACTGCAAGGTGTGGAA
CTAAGTGAGGGGTGCGCTTCGTTTTTTTTTTTATTTTTTCAGATGTGGTTCAGCTCCAAA
GACCTTAAAGTTTGGAGGATGAGATAAGACCTGTCTCTATGAACTAGGCATTACCGCGGT
GCTCCGGGTGGGTATGCAGGGATTTCCGCAGGTGTGGGCGGGCATGGTGTCTAGGTGGGG
TTGCTTCTTGTTCAAATTGTGCTGACCACTCTATGATGAACATAAAAAAAAGACAAGCAT
ATGGCTGAACTTAGAAGTGATGTCATCTTACTGCTGAGAAGTGGGCCAAGAGTACTTAAG
GGTCTATGACTATAGTCATAGAAGTGATTATTGCTAGGTACATGTAATGCTTTCTGTTTC
TGCGTGTAGCATCTCTTCTCTAAGCCTGAGAAATCCAACTGACCTCCACAGTGAATACAG
GTAATAATTGTTCAAATGGGGGGAGGGGTTGGAGAATTCTCTCCAGTTTTGCCTACAATC
AGAAGAGCAAATGTCCAGTGGAGCAGTGTTGCCTTTTTGCTCCTTCCAGCTTGTTCCTCT
TGGAATGACTTTTCCTGTGGAGGGAGAGAGCAGCCCAGCTGTATACTTCTTGTGAGGCTA
TGCTCTCCCTTACCCCATACGTCACTGTCAGATGATTTGAATAGATATGCTGATCCTCTG
TGAGGTACAACAATTAATAGCATGTTAGAGTTCTGATGACAGTTTCTGTTACCAAGGAAA
CTTTATTCCATCCTAATATTTTTGGGTAACTGTTTGTTCACCTTTTACAGGTTGACTTGA
TGGTGATCCATTCATCTATTCACAGTAAGAGCTTTTCCCAGTATTGTGATTAGTTAGCAT
ATATGTGAATCCATAATCCAAAGGATGATGTTATCATCCTAGAGTTTTTTTGGTTTATTT
GAGCAGAGACTTGATTGGCCCATATAGATTACTGGTTCTTTTTTGTTGTCTGTTAATCTT
TTTTTCTGAGTGATTTTTTTTTTTTTTTACAAGTAGGCTCTGTGCCCAACATGGGGCCGA
AACTCAGGACCTCAAGATCAAGAGTTGGGTGCCCCACTGAGCCAACTGAGCCAGCCAGGC
ATCCTTTGCTTTATTTCTTCTGGGTACTCCCTTGATCTGTCCAGGGTTGAGCTCTCCAAA
AGCAACATTAAGGATGGTGAGTACTTGTAACCTTAATAGTTGTGGCTTGTCCCGAGTATG
TGCCGGTGAGGAGAGCAAGCATCCTGTCTTACCCCCTGTTCAGTTCCAGAGCCAGTAATG
GTGAACCCACTGGGACTGACTGGGAGAGAGGATGAGAATTTGTTCCATAGGGAACAGTCT
GAGGCACAGCATATGCCTGTTAGTAACATTTGTTTGGCTTTTCTTAGCTTAAATCCAGTA
GCCATAGCTAAAATAGATTTTGAATCTTCACTAATTTTTTGGATCCTTCACTAATTATGT
GATCTCTTTCAGGAGCAGCTTGTTTCCTGTATGCTACCCCAAAGTCTCCAGAGTTAACAG
GTTAGTTGATTAATGTCTGTGGCTCATGCCACCAAATCTGCAGTTTCCATGATGAGTCAA
ACTAGCTCACTATGACTTACACAATGAAAATAAGTGAACACCTGAGAAACTGGAGACAGC
AGGAGTGGAGGGATGCTATGTGGAAGGGCCTTTTTTTATTCACCCACATCTTCATCCTCT
AGGTCCTGTTACCTATAACCTGCTTGTTTGCTGAAAGGTGAGTAGTTTCCTTATGTGGTA
CATGAAATACATTGGGCAGAAAAGTACCCTTTTGGGAGCCTAAATCCATGATGACTTATG
TGGAATCTCGTTCGGCTGATAACTTGCTGTTGAGACTCGGAATTCTGACTTTCCTAGGAA
TGATAGTTTAAGTGGGAAGAATTTTTATTGCTAGAGGTAAGCATTACTGATTCCCTTATT
TGTATCAGGTCCAGTACCTTGTGTGGGACTCAAGAATGATTTGAGGTAAATGCCTTTATA
ACCCTATTATTTGGTTGCTATAAATTGGGTGGGGGTGGGGGTGTTTGGTGGCACTTTGGT
CTTGGTAGTTGTAAGAAGACATTACTGGTTTACTCCAAAGTTCTGTCTGGCCATTCTGAA
CCACTTGCAACAAGCTCCCCCTCACCAGTGATGAATTCAATACCGCCCCAGTCTGATCAC
CGTGACTGAAAGGTATTTTCTGAGCAGTGAGCTTGTCTTGCTGAGGTGACAACGGTGAGA
AATTTATCAAGTAGGTTTTAAGCCAGTAGGAAGTCTTGTGGACTTACTGGTGGTTACTGA
AAAATATGTGCTGAAACCTTAGCTCATGATGAGAGGCTTAGTTGTCAATCATTCTTTTGC
AGGAACCCTAAGCCATTTTTCTGTTCAGCTCCAGTCTGAGGCAAGTAAATCTACATACAG
AGTAACCCAAACTAGAAGCTCCCAGTGAAGAAACAGTCACATGTCTTACCTCCTGTCCTA
GTCCCAGAGCCTGTAAAGGTGAACCCACTGGGGCTGGCTGGGGGAAGGAAGGAGATTTGC
TCCAGAAGGAACTGTCTGAGGGATCATAAGGGATTTCTAAATATGGGAAAGGGGAATTAA
TCATTTGGTGAAGTCAACTGTACGTACTTCTTTGTAGGTCTAAAGAAAGAAGGATCCCTG
GGTGGTGCAGCAGTTTAGCGCCTGCCTTTGGCCCAGGGCGCGATCCTGGAGACCCGGGAT
CGAATCCCACGTCGGGCTCCCGGTGCATGGAGCCTGCTTCTCCCTCTGCCTATGTCTCTG
CCTCTCTCTCTCTCTCTCTCTCTCTCTGTGATTATCATAAATAAATAAAAAATTTTTAAA
AATAAAGAACAAAGCTTTTATGTAACAGGTATGTATCTGTTTAAATATTGGTGTTTCGTA
TTTAATAGACCAGGATAAACGAAAAATGTACCTAGAAAAAGGCTTTTAAAATGTGACCTA
GGGGACATCCGTGGGTGGCTCAGTGGTTTAGTGCCTGCCTTCAGCCCAGGGCATGATCCT
GGAGTCCCGGGATCAAGTCCCACGTGGGGTTCCCAGGAGGGAGACTGCTTCTCCCTCTGC
CTGTGTCTCTGACTCTCTCTCTCTCTCTCTCTATCATAAATCAATCAAGCAATCAGTCTA
TCTTTTAAAAAAAAAAATGTGAACTAGGGGCAGCCCGGGTGGCTCAGCAGTTTAGCGCTG
CCTTCAGCCCAGGGCATGATCCTGGAGACCCGGATACAGTCCCAAGTCAGGCTCCCTGCA
TGGAGCCTGCTTCTCCCTCTGCTTCTGTCTCTGTGTGTGTGTTTTAGGGTTTTACTTATT
CATTAGAGACAAGCAGAAGGCTCCCTGCAGGGAACCTGATATGGGCTAGAACCCAGGGAT
CACAACCCCTGGGTTGTGACAGATGATCAACAATGGAGCCACCCAGATGCCCTGAGCACA
CACCGACCATTGTGCCTTGTTGAAATGTTGGCTGGGTTTGGGTGATTAACTTTGGTGGGC
TTGGCTGCAGGCACTGAAAGTCAGTGGGACATATGGACATCAAGGATTCCTTTATTCAAA
AAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved