Canis_familiaris Locus Mono:33:SNORD36
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:33:SNORD36
Canis_familiaris
Mono:33:SNORD36
5
SNORD36
1001..1076
2076
CTATTCAGGCATCTCACCAGGGCCTCAGACCGAGATAAAGTCAGACTTCTGAGGGAGCT
TGTCTTTGTTGTTGTTGATAAGAATACATTTACTGTGAATAACTCGGGCGGTCCTTTCTT
CTGTTAGTAAAGATACTCAAAATATTATTACACCTAGCTTTTAAATGCTCTTCTCCACAC
GAGAGCAGCTCCTTTAAAAGTAAAAGGGCTTAAAAGCTGATCAAGATAGATCAGAACTCT
GATCATTGTAAGAAGAGATTCTGATAAAAAATTAGAAACCTTTCCACCTAACATTGTGGC
TCTGCCTAATTTGTTACTTAAAGTGAAATGCTCAATGCTATCAGAAGGCTGTATACCGAA
AAATGTAAAAATCTTAAAAGCCAACAAGGTCTTGTCAGCTCCTGTCCAATGAGACTGGGA
GGGATGAAATCACCTGCTCAGCCAGGAAGAATGCTGCACAGATGAACGGCTCCTGGAGAC
CATCTGGTCAAGCACACTGAGCACAGACAAACCACAGAGACAGTCGGGGCTACTGTCCTC
CCAGGCCTTTCGTCTGGGTCTCCTACCTTCAGCAGTACACTATGCAGAATTCTAACTTTT
CTTTTTTTTAAAGAATTTATTTATTTATTAATGAGAGACACAGAGAGAGGTAGAGAGAGA
AGCAGGCCCCATGCAGGAAGCCTGATGCAGGACTCAATCACGGGTCTTCAGGATCACGCC
CTGGGCTGAAGGCAGACACCTAACCGCTGAGCCACCCAGGTGTCCCGAATTCTGACTTTT
CTATATGGGAGGCAAATGTTGCTAACCTCCACTCACGATGTGTGAGACTCAACAGTAAGG
TCTTTTCTCTCTCTCTCTTCTCTCAAGAGACCAAGAAGACAAGACAAAACTACATGGAAA
AATGATGTTTTTCACTCTTATGTTTCATTGCTTCAGGTCATTTCCAATCTATAAGGAAGC
GACTAAACAGCAAGCCCTTAAGTAAGTTGATGCCTGCAGCTAGGATTATAAACTTTAACA
AGTCTCACCTGGAATCTCTGTGAAGCATAAAATCAAGCTTTTTAACCCTGAGTCACAGCT
GGGCCCAGAGTAGTAGGACGGCTTTTGTGAAAGGAGCAGTCCTCCAGGGTTAATGGGTTC
TGTGTCCTAGGGGTTTACACTGTCACCACCTCGGTGGAAAACAAGAAGGCTCAGCTTGTA
GTGATAGCCCATGATGTGGATCCCATTGAGATGGTTGTCTTTCTGCCTGCCCGGTGTTGT
AAGATGGGGGTTCCCTACTGCATTATCAAGGAGAAGGCCAGGCTGGGGCATCTGGTCCAC
AGGAAGACCTGCACCACTGTCGCCTTCACACACGTTAACTCGGAAGACAAGGAAGTTCTG
GCTAAGCTGGTAGAAGCCATCAGAACCAATTACAATGACAGATATGATGAGATCCACCAT
CACTGGGGAGGCAACGTCCTGGGTTTGAAGTCAGTGGCTCACATCGCCAAGCTGGAAAAA
GCAAAAGCTAAAGAACTGGCCACCAAGCTGGGCTGAGTAGACGCTGTTGAATTTTCTGTA
CATAAAAATAGTAAAAGCTTCTCTTTCAAAAAAAATAAAAAATAAAGATAAAAAATAAAT
AAACTTTAACAATAGCCTACTGCTGGAATAGGTGAGTAGTAAGTGTGAGGATAAAGGCTG
ACCTACCCAAATACCCACGAAAGCTGGATTCAAATGGCTGTTGATGCTGGAGTGGGGACT
GGCGGGGCTGTGGGCAGCCGTGGGGAGCATTCAGGGCAAGAAATGGATCAAGAGTTTAGA
ACAACAGGACTATAGGAATTCAGACACACTGAGCTGACTATTGTGCTTTCTACAACTAAA
TGTAGAGAACGCTTCTTATTGTCTCTGATTTCTGCCTCTAATTAAAATCGGGTGTTTGGT
TTACTTCATTCCCAAAGCATAAACTTTGGCTTTTTATAGCCCAAGCAGTGTGCTATTTTA
AACATGTAAAGGAAATGCATTTTCAGTTACAAACATTTGCTCCTGTGAATCTGTTCTTAT
TTGCTAGCAAAGGATGTGGGACAGGATGTTTTACCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved