Canis_familiaris Locus Poly:1:SNORD116
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:1:SNORD116
Canis_familiaris
Poly:1:SNORD116
Un
SNORD116, SNORD116
1001..1094, 4116..4210
5210
AAGTGGGTATTTGGAGGAGAGTCCTTGTGCTGCGCTTTGCCAGAGGGCTTCGGACACGT
GGTGTCTCAGGGCTTTGCAACGTCCCCTGAGGTCAGTCACGTCATCTCATGCTATTACGT
GCCAGCGTCTGAGGCCATGGATCCCCGGATTGCCCATGTACTTTGCGCTGATGAACTCTA
AACGTTAGCTCCTGAGCCACGGATGGCCAGCCTGCCAGCCTGCCAGCCTGCCCTGCACAC
GCACGCATGTGCACACCTGCTTGCTGGTAAACCCATAGAATCACACTGATGCACACACAC
TCAAACACACCCACAGAGGGCCCCACAGAAACAGACGCATGCACATCCCCACTCATGGCG
TGTGGTCTTACCAGAAACATTGTCATATTCTAACAAGGAAATTCCTAGACACACATGAGA
CAGAGGCACATCCCCTTGTGTGGGATGACGTGGGCCCGTTCCATCTCACTGATGAGCAGC
TAGCCCTGTGGGACAGAGGGACAGCACAGGGAGATGCAAAGCTTCCCCCACGGAACCGTT
TGGATCGCTCAGGCCACCTGAGCGCCTGGGTGGGTACGTCACACATTCGCCTGATTTCTC
CACACCTCCTCAGGTGCTGAGGCCTAGCTAGGCTTCCTGTTGACATGGAGAAGACGACCT
TCCTTTGTTTTCCATGGTGGTGTGGAGAGATGCTGGCGGGCCCTGTGGAAGAAGAGTGGT
CCAGGCCGGGGAACTTGCGCACGGATCACCAGAGGTAAGCTTTTGTTGTCTCTAAGTGTA
CTGATGGCACTAGAAGGTCCTGAGATGGCCTGCGGACCTGCCAGCCGGCTTGTGCTCCTG
GCCATGGACGTTGGCTCTCCAAGAAGATTGCCTTTGCCTCTTGCTCAGGGGCATAGCTGT
GGATGGTGTCCAGGGTACTGGAGGGTGCTGAGGCCACGGGGAGACCCTATGAGCTGTTCA
GCCTGTGTAGTTCAATATACCAGGAGGCCGAGAAAGTGCTTGGATCGATGATGACTCCCT
CAATCTGCATTCCTGGAAAAGCTGAACAAAATGAGTGAGAACTCCCTGCCGTCGTTCTCA
TCGCAACTGAGGTCCAGCACGTTGTCTCCCCCAGGGAAGGAAGGAGTGAGGGACAGCTTC
GTCGTGCCACACGCTAGCAACCGCCACCACCACCACCACCACCACCACCACCACCATCTC
CACCCAAGGGCCCTGGGATCAGAGTGCCTGGCGGAGGGCTGAGGGCCTAGAAACCGTGTG
CTCTCCTTGGGTGGGAGTCCTCGACTTGGTGGTCCTCCATGACATGTCTGGGCTTTGGTG
GCGTCTCAGACAGCCAGCAGCCAAGTGATAGGAGTTGCGTTAGGCGGGTTTGGCAGGGTC
TTGAGAGCATCTATGTCAGAGTACATCGGCCAGGCCAAAGATTGAGCCAGTTCTCCTGCT
GGTGTGTGGTGCCCCCCTTTCAGGGCCAGGTGCCGCGAGTGTACAGTTGGACTCCCGACT
GGGCAAGGAGCAATCTCTGTCCCAGGCCTCTGTCCCACGTTCTCAGCTGAGCGCTGAACA
GGGTTGCGGGAGGACAGGAAAGATACCAGATGGGTTCGGTGCATTTGATAGAGCCGTAAT
TCATCTGAGGCCAGACAAGGACAGAGACACACAACTCGTACACGCGCACAAATACACATA
CAAACATACAGAAGGACACACACAGTCACACACACGCTCACACAATCATAGTCCCATGCA
CAGGCATGCAAACACAAACACACACACACACAACACACACACACACACTCACACAACAAA
CACACCAGGAAGTCCAGGAGAGCTCATGGTGTACGTTCAGGGCAGGAGTGTAGAAGCTTT
GCTGGCCACTGGGAAGAATGGGAATGGCAGGGCCAAGGGCGTCCGGAGGAAACGTGCGTG
CGGGCAGGGCAGCTGACGGCCTCCCTACCCCTGGATGGTGTTACGAAAACCAACGGGTCA
GAGCTTCGTGGGCTGTTTGCGGCCCCACCACCTTCCCCCATGGGCTGCGATTTACAGCCT
TACGGGGCCGCCTGCCGATGGTGCCGAGGGCTCTGTCCGACCCACCCCTAGCCACGACTT
TCCCAAAGAAGGGCTCTCCTGGGTGTCTACCCTGTGCCTGTGATAGCCTTGCCGGCCATT
GCCACCCTGGTTGTCCCTCCCTTGCCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCTGTTCTTGCTGAGGATCCCAGCCCCTGA
CGTGGGAGTCCCGTTCGAGGGCAGAGGTGACCTTCCCTGCAGTGATGAGGACTCAGGACA
TGGACCCGGATGTGGCAGCCCGACTAATGGCAGGTGTTCCCCAGAGGCCGAGCCCGTGAG
GCACAATGGCCGTTGACATGCCAGGTCCCTTGTCAGTAGCGCTCCCCCGCTTCAGGCGGC
TGTTGTTTGGCTTTCAGTGTGGCATGGGCACCACTTGCCTAGGGCTGTTCTGCCCACACG
CCAAGAGCCAAATTGTCATGTGCGTGGGACCAGTCACCTGTCCGACCTTCGTGTGGCCAC
CTCTTCTCATAGGGCTTCGTGAAGGCCTGAGGCGTGCATCCATTCATTATCTGAGGCCCG
CTGCCCTCACAGGGCTCATTGCCTTTCCCCATGGTCGCTGAGGTTTCATGCTGCGCCCGG
TAACGGCACAGCTAATGGGGCAACGTAATCCACATCGACATCGCTTCGAAGGTGGAAAGT
GGGTATTTGGAGGAGAGTCCTTGTGCTGCGCTTTGCCAGAGGGCTTCGGACACGTGGTGT
CTCAGGGCTTTGCAACGTCCCCTGAGGTCAGTCACGTCATCTCATGCTATTACGTGCCAG
CGTCTGAGGCCATGGATCCCCGGATTGCCCATGTACTTTGCGCTGATGAACTCTAAACGT
TAGCTCCTGAGCCACGGATGGCCAGCCTGCCAGTTTGCCAGCCTGCCCTGCACACGCACG
CATGTGCACACCTGCTTGCTGGTAAACCCATAGAATCACACTGATGCACACACACTCAAA
CACACCCACAGAGGGCCCCACAGAAACAGACGCATGCACATCCCCACTCATGGCGTGTGG
TCTTACCAGAAACATTGTCATATTCTAACAAGGAAATTCCTAGACACACATGAGACAGAG
GCACATCCCCTTGTGTGGGATGACGTGGGCCCGTTCCATCTCACTGATGAGCAGCTAGCC
CTGTGGGACAGAGGGACAGCACAGGGAGATGCAAAGCTTCCCCCACGGAACCGTTTGGAT
CGCTCAGGCCACCTGAGCGCCTGGGTGGGTACGTCACACATTCGCCTGATTTCTCCACAC
CTCCTCAGGTGCTGAGGCCTAGCTAGGCTTCCTGTTGACATGGAGAAGACGACCTTCCTT
TGTTTTCCATGGTGGTGTGGAGAGATGCTGGCGGGCCCTGTGGAAGAAGAGTGGTCCAGG
ACGGGGAACCTGCGCACGGATCACCAGAGGTAAGCTTTTGTTGTCTCAAAGTGTACTGAT
GGCACTAGAAGGTCCTGAGATGGCCTGCGGACCTGCCAGCCGGCTTGTGCTCCTGGCCAT
GGACGTTGGCTCTCCAAGAAGATTGCCTTTGCCTCTTGCTCAGGGGCATAGCTGTGGATG
GTGTCCAGGTTACTGGAGGGTGCTGAGGCCACGGGGAGACCCTATGAGCTGTTCAGCCTG
CGTAGTTCAATATACCAGGAGGCCGAGAAAGTGCTTGGATCGATGATGACTCCCTCAATC
TGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCCCTGCCGTCGTTCTCATCGC
AACTGAGGTCCAGCACGTTGTCTCCCCCAGGGAAGGAAGGAGTGAGGGACAGCTTTGTCG
TGCCACACGCTAGCAACCGCCACCACCACCACCACCACCACCACCACCACCACCAGCAAC
ACCACCACCATCTCCACCCAAGGGCCCTGGGATCAGAGTGCCTGTGCGGAGGGCTGAGGG
CCTAGAAACCGTGTGCTCTCCTTGGGTGGGAGTCCTAGACTAGGTGGTCCTCCATGACAT
GTCTGGGCTTTGGTGGCGTCTCAGACAGCCAGCAGCCAAGTAATAGGAGTTGTGTTAGGC
GGCTTTGGCAGGGTCTTGAGAGCATCTATGTCAGAGTACATCGGCCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved