Canis_familiaris Locus Mono:131:SNORD43
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:131:SNORD43
Canis_familiaris
Mono:131:SNORD43
10
SNORD43
1001..1064
2064
GCTTTCGCTCTTTTCTTTCCAACTGGAAGCAGGTGGCAGCGGGGCAACTCGTCCCAGCT
CAGCGTGCCCGCCAAACGGCAACACCGCAGATCCGCTGCGTGGGACGGAACCCGGAGAGG
CGTGTGCGGGCGCTTCGGCACTGAAACCCGCAGCCGGGTTATCCAATCCTAGAGGTGACT
GCATCTCACAGGAAAAAGACGCAGCCGCGTAGCTTCAGCGTAACGGCGTCTTCGACCAAA
TTTGGCAGCTACCCAAACCCCTACAGTCGTCGCGCTCCAAAGCTCTGCCAGCGTTTCCGC
GACGCTTCGCGAAGTTTGAACCCAGCCGCTTGCCGTAGTTTCTAGTCCCCGCCCCCCGTG
GACGGCGTCCCGCTCCGAAGCAAACGCTAGGCGAGGACGAGCGAGCGTGGAAATGGCGGC
CTGCACCCGCCCCCCGACCCAGCGTCCCCCGCGGGCGCGCGCTCGTACGCCGGAAGGGGC
GGGCCCAGGCCGGGCTATATAAATGACTGGTCGCTCGTGGCCCGACCTCTACCGGCTGTA
CTGGGCGGCACGATGGTACGTATCATGGCGGTTTCCTCCTCGTTGGCGCGGCGGTGGGGC
TCAATCCGCGGCGCAGCGCCGCCATCTCACCTCGGCGGGGGCCGGGGGCCTCCTCCAAGA
GCGCGGGGCGCTTAGCGCGATCCGCAGTGAGGCCTATTTTCTGAAAACGCGTGAGGCTTG
TGGTTGGTTTGGGGCCCGCCAGGCGGCTGGCGAACGCCCGCGGGGCGGGCTCCGGTATGG
AGGTCTCGAGTCCCGGATAATACCTGGGGCTCGAGCTCACTGAGTTGGTGCTAGTGTAAG
CTGGAGTTCGTAGGTACGTGGGCCGGGAGGACCTTGAGTCGGGGCGCTGGGCTTGTGCCG
GCACGTGGGAGGGGAGCCCGGGCTGGGGTTGCCGAGGCCCCGCGCTGACCTGCGTGGGAG
GCCGGTACCACCCGTGAGGTGAGGCCTCGAGTCCTAGGAGCCACAGATGATGAACTTTCT
GACGGGCGGACAGATCCTCTGTGCTGATTGTCACGTTCTGATTTGGCTCTGTGGTGGCCT
TCGTGTCTGGGGCCGGCGGGGAGCCCCTTGGTCCCCGCAGCCCCCTTGTCAGGATCTGGG
CTGACTGGATGGCAGAGGCACCTGTGACTTAATGACCTCACCTGGTGTGCTTTTGGCCCA
TTTAGAGAAGGGGAGGTTCCATCTTAAAGTTACAAAATGAGGTTTTGAGGTAAAGATTCA
GTTTAGGCCGCAGGGCCTTGTGCAAGGTGAACCCAGTCCAGCCCGTAAGCACACTTGTTA
GCTGGGGCGCAGGGCCTCTGGCGCGGGCTCGGCATTGTGGAGAATCCTTCGCCACTGAGG
CAAGCCCGGCATCAGGAGTGAGCTACATAAGAGGGGTTGGGAGTGCTCATGTTATCTTTT
CTCCCAGTCCCACAGGAAGTTCTCCGCTCCCAGGCATGGGTCCCTGGGCTTCTTGCCTCG
GAAACGCAGCAGCCGCCACCGTGGGAAGGTGAAGAGCTTCCCCAAGGATGACTCTTCCAA
GCCTGTCCACCTCACAGCCTTCCTGGGCTACAAGGCCGGCATGACTCACATCGTGCGGGA
GGTGGACCGGCCAGGATCCAGTGAGTACAAGCGGGATCCTTCACGCTGGTTGGGGGTGGC
CTGGACGGTAGTCCCGAGAGGGCAGACTTGACGGGGTGGGAATCCCCATGGGGTTTGATT
AACACTAAAGACTGCGGGTGGCTGGTGTTGCTTTAGGTGGGGGGATGTACTGAAGTCAGC
GTTACGAGTAAATTTTTTAACTTTTTGTAAGAGTGCTCAGAGTGAGCAGGGGGAGAGAGA
AAGCAGACTCCCCACTGACCAGGGAGCCCAATCCCCGGACCCTGGGATCATGACCTGAGG
TAAAGGCAGATGCTTAACCAACTGAGCCACGCAAGTGCCCCAGAGATTTGTGATAGATGA
GAATTAAAACGAGTCAGCGAAAGAGTTTTGTTGAGTTAGAATTCTAATGTATGGAGTAAG
GACAAGCCTGGGAGTCTAGACGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved