Canis_familiaris Locus Poly:20:SNORA63
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:20:SNORA63
Canis_familiaris
Poly:20:SNORA63
34
SNORA63, SNORA63
1001..1131, 2103..2233
3233
AATAAACTTTATATTTTAGAACAGTTTTAGGTTCACGAAAAAAAATGAGAAGATAATTC
AGAAAGGTCTCTTATGCATTGTCACCAGTTTCCCATATTCTTAACATCTTACATTAATAT
GGCACATTTGTTAAAATTAATGAACCAACTGACCTTGATACAATAGGATGAACTGAAGTC
CAGAATTTACTCTGATTCCTTAGTTTTTACCTAATGTCCTTTTTCTGTTCCAGGATACCA
CATTACATTTAATTTTCATGTCTCCTTAAGCTCCTCTTAGCTGTGACAGTTTCTCAAATT
TTCCCTATTTTTGATGACTGTGACAAATTTTAGGAGTCAGATATTGGTCAAATATTTAGT
AGGATGTCCTTGTATTGGAATTTGGTGTTTTTCCTCAAGATTAGATTGAGGAAGACCACA
GAGTGATCTTTTTATTTGAAAAGTGCCATTTTCATTTCATTGTATTAAAAAATATTGCTG
TTGGTTGATGTTGACCTTGGTTCCCTGGCTAGGGTTGTGTTTGTTAGGTTTCTCCAGGTA
AAGTTACTCTTGTCACACACACCCTTCCATATTGTATAATCTTTGGAAAGAAGTCTCCAT
GCACAGCCCACGCTTAAGTAAGATTTTTTTTAACTTTCCAAAATAGATCAAGATGCTTGT
TTTGGATGAAGCAGATAAAAATGCTGAGTCAAAGGATTAAAGATCAGAGACGCCTGGGTG
GCTCAGCGGTTGAGCACCTGCCTTCGGCTCGGGGCATGATCTTGAAGTCCTGAGGTTGAG
TCCCACATCAGGCTCCCTGCGTGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTTCT
CTCTCTGTGTGTCTCTCATGAATAAATAAATAAATAAATAAATAAATAAATAAATAAATA
AATAAAATCTTTAAAACAAACAAGCAAAGGATTAAATATCAAATCCACAAGATTTACCAG
AAATTAAATACAAGTATTCAGATGTGCATGTGATAGCTGGCAGGTTGGGTTACTTGTTAC
AATATAGCTGTGAAGTGCTATATTGTCCTTACCCCTGCTGAAAGCAACTGTTTCCTACAA
TCTCTGTCTAGCTCAATTCTATAGTAAGACAGGGACGCTTGGTCTCAAACATATTCCTCT
ATGTACTATTATGAAAACGATTATACCTGCTTAATATGTCAACATAATTAGTTCTCTTTT
TTCTTTTCTTAAGGTTGGGTTGCTTTCTGCCTTAATGTCAATCGATACATTGGAAGTTAT
CGAGAAGTTCAAATTCTGATGAAGAAGGAAGAATTGACCCTTGAAATGGTTGATATTTTA
TAATATTTTAATAAAAGGGTAATGTTTTTCCAGTTGATACCCATAAAAACTATGGCCCGA
ATTATTTTTACCTGCTTACTTAAGCTCTGTACTAAAATTGCAGAAGCTAGTATCATGTCT
TAGTATTTGTAATAAAGCTAGCAGAGTAAACACAAGAAGAAAAACAGGTATGCCAGGTAG
TAGAAAAACTGAGATAAATGTCTTTCTTGAGTTCAGGGTACTCTGTTCTAAGATTTGGTA
AGATAATATCTGCATTTAGGCAGAATTAATAGAATGAATTTCTAACTAATCCCTTTCAGT
GATAGGGATGAGAATTAGAGGGGATCCCTGGGTGGCGCAGCGGTTTGGCGCCTGCCTTTG
GCCCAGGGCGCAATCCTGGAGACCCGGGATCGAATCCCACATCGGGCTCCCGGTGCATGG
AGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCACTGTGTGCCTATCAT
AAAAAAAAATAATAATAATAAAAAAAAAAAAAAAGTAATTTAGAAATCAAATGGTGTTTT
ATTCCAACTCTGATAGGAATTAGTATTTTCCTCTCTGAAATACTGGAAGGAAGAAAATTG
TATGCTCCTTGTGTCATATGATAGACCACACATGACTTTTCTTTTTCAGAACACAAGGCA
AAGGGTAGACTGCCTTCTGAGAAAATACATGCCAGGAATTTCAGTATCTAATATATGACT
AGTTCTTCCCTACTGTTGCTGCTTAAGATACTGTTAACATCTAATTATTTCCTTAATAAA
ATGATGCAGGATCTAGTTACAATGTAGCTATAAAGTGCTGCCTTGTCTTTACCCCCTGCT
CAAAATAAAACTGTTATCTTTCTAGCCCTGTCCGCCATGGTGCTTAGCAGCCAGGGATGC
AGGGTCTCAGACATGATTACCAAGTTAACCCCTGATTTGAGGAATGACTCTTGAGAATTA
ATGCTTGTTCATATTTGCAGGTGGTGACAGAAAGAGACATTATCAAGAAGGAATTTGGAT
AAGGCACAAACCAAATTTTGATTACTACCGACTTACTGGTATTCCAATTCCTTATTTAAT
TGTATTTATCTACCACAAGTGGGTTTTGAGGGGAAGATTTTTAGTAGTCTTGGTCATCTC
TAGCCCCGTGGGGGATAAAAACCTCACTCCACAGTTAGCTGTGTGATTTATATGTGGCTC
ATTATTATTTTGTGGCCTGGAAGATGTATAGCAGTTGCTTTTTGAATCAGAATTTGAATA
TCTACTATCATACTTTCAGGCTCATGACTTTTATATGTACAACTAGTGTCTATGGTTATA
AACTATGATCATCTGCCTACTACTTGTGAAATCTATATTTTCAGCTATTTGTCATCTTCA
TTGAATATTTGCTTTTATTCAGGTGAAATAAATTTATGTATTGTCATTGAAGTGTGATTT
TGTTAGCCAGTCAACCTTTAAAATCAGGTATATGGGGATGCCCAGGTGGCTCAGCGGTTG
AGCTCCTGCCTTTCGAGCCCAGGGTGTGATCCTGGGGTCCTGGAATTGAGTCCCATGTCG
GGCTCCCTGCATGGAGCCTGCTTCTCCCTCTACCTGTGTCCCTGCCTTTCTCTCTGTGTG
TCTCTCATGAATAAATAAATAACATTTTAAAAAAAAGACTTCTTTTAAAAAAAATCAGGT
ATATGAATAAGGAAAATCTTATCACTCAGTTAACATGAGATGTATTTTTTTAAAGATTTT
ATTTATCTATTCATGAGAGACACAGAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGG
CTCCATGCAAGAAGCCCGATGTGGGACTCCACCCCAGGACCCCAAGATCACGCTCTGAGC
CAAAGGCAGACACTCAACCCGAGCCACCCAGGCGTCCCACATAAGATGTATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved