Canis_familiaris Locus Mono:137:SNORA28
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:137:SNORA28
Canis_familiaris
Mono:137:SNORA28
24
SNORA28
1001..1125
2125
GTCCTGATAATTCTACATGTGTTAAATCCCTTAATCTTCCACATTATCTTGGGAATTTG
TCGTTCCGGCCTTGTAGATGAGGAAACAATCACATAAAGGTTAGGTTATGCCCAAGACCT
AGCATTAGTAAAAGGTGGGGCTGGGCTTCAATCCTGGCTCTTGTTGCTCTTTGCGCGTGT
TTAAATTTTTTGTTTTGAAATCATTTTAGATTTACAGAAAACTTGCAAAGATAATACAAA
GAGTTCCCATATACCCTCTACCTGGATTTCCCTAATGTTAACATCTTACGAAAGCATGGT
GCATTTACCAAACTAAGAAGTTTATACCAAAAAAAAAAAAAAAAAAAGAAGAAGTTTATA
CCAGTGCAATACTAGTAACTAACCAGAGACTTTATTTGGATTCACCAGGTTTTCCACTCT
TTTTCTATTCCAGGACCCAATTTGGGGTCACACATTGTGTTTAGGATATATACATGTATT
AAAAAAAAAAACTTTTTGGCATGGAAGGTTTCAAGTTATATAAAAATGGAGAGAACAGGA
AGATTTATCATTCAGCTTCAGTGATTAACTCATGACCAATTTGTTTCATTCACACCCTAA
ACCATATTACTTTTTTCTTTGTTCTGGTCGCCTATAGTTTACAGATGTATGCCCTATAAA
TCACCTTATTTCACCTGCTTCCTATACAGCAGTTCTGTAGTTCATGGGCACTTTATTAAT
TATGGAGTTTCTAAAGCCAACACCTAGAACAACAACAACAACAACAACTACTACTACTAC
TCGTAAGAAGAAATCTTTATTTCACACTTTGTAAAAAGAATTAAAGGGCCCAGGGGTGGC
AAAATTATGATTACTTAAAAATAATTTAGTTAACATTTCCTCCTGAAAAAGTTTCAAAAG
ACTTAAATAGTCTTTTGTTGTTTAAAAAAGTGTATTTTACTTTTTTTTTGCCAGATAATA
TAGTCACATATATTCACACATAAGAGGTATTGAAGGGTTGCAAGCAACACTCTGTGGCAG
ATGACCAAATTGTCTGACACAATATGAGCTTGCTATAGCAAGAAGATCTAACCTATTCCA
GCGTTTTCTCCTCCATGAGACCAATTGTTATATAGATTTAAAAAGTGTTCCAGCTGTTGG
CTAAAGTGCAGTTGAGATTTGCGCTTGTTCAGGTTCTTGAGGGAGGGAAGAGTCAGTGCC
AATCATCACAAACTTCCTGGCCTTCTGAGGCCAAAGCATTACCACTTCGTCCTAATCTTC
AACAGTTAATCCTCTATTACTTTGGGACATTCCATTCTTAGCCTGAATTTCTTACCTATG
AAATAGCAACAGAGGGGATCCCTGGGTGGCTCAGCAGTTTGGCGCCTGCCTTTGGCCCAG
GGCACGATCCTGGAGTCTCGGGATCGGGTCCCACGTCGGGCTCCCGGTATGGAGCCTGCT
TCTCCCTCCTCCTGTGTCTCTGCCTCTTTCTCTCTCTCTCTCTCTGTATCTATCATAAAT
AAAAATAAATAAATCTTAAAAAAAAAAAGAAATAGCAACAGATCAATTTGGTTTGTGAAT
CCTCTTAGAATTGCAGGTAGCGGGCAGCCCTGGTGGCTCAGTGGTTTAGCGCTGCCTTCA
GCCCAGGGCGTGATCCTGGAGACCCCGGGTTGAGTCCCACGTTGGGTTCCTTGCGTAGAG
CCTGCTTCTCCCTCTGCCTGTCTCTCTCCCTCCCTCCCTCCCTCTCTCTGTGTGTGTGTG
TGTGTCTCTAATGAATAAATTAAAAAAAAATTACAGGTAGCATTGTGTTGGTGTGTGGTT
TTCTGAGGGGAGGGTTTCAAAGCAAAAGGGGGAAGGGTTTTTGATGTTTATGAGACACAG
GTGTAAAATAAACCATAGGATTAAACTTTTACTTCTTTGTCTCCCTATAGGAAAAATAAA
AAGAAAGTATTAAAGGGTCTATAGTAAAGTCACTCCCTTCTGACTTTTTGTCACATAGTT
CTCTTCCCTTTGGAGAGCTGATAAGTTTCTAGGGAAGAGACCAGCCAGCTTTTTCTGTAA
AGCATCAGATAGGAGACATTGTAGGCTTTGTGGACAGACCCCTGTTCTAGTGTGTCCTTG
AAATTTTATGCAAATATAAGCACATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved