Canis_familiaris Locus Mono:153:SNORD87
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:153:SNORD87
Canis_familiaris
Mono:153:SNORD87
29
SNORD87
1001..1089
2089
GACTTGAAAATGATAAATTGTTTTGCAAGGTCCAACATTTGATGTGTCTTCATAAATCA
TCTCCAGTAGCTGTCTGGTTCAATGCTTTATCCTCCTGGGGTGCTGTGGGATATGATCTG
TGGCCCTGGCGGTTCCCTTTGCACTACCTAAGTGTGCTTTCAGGCAACCTGGGATTTAAT
TCTACAAAACTGTCCAATAATGATGCCAACATAATGTATCTGCTTTAAAGCTGTATTAGA
TTTGCCATTGTGATGCTTTAGTTGGAAGTCTGCACACTTGTTTCTATATGTGTAACCTTT
AACCTGACTCATCTCCTTGTCAAGCTCTGAGACAGAAAAGCAATGGTTAGGTACTCATTA
GGACCATCATGTCTTAAAATCGATACTGCCAAGGTAAAGAACATTGTATACACCGTTTTT
TCTGTCCATGCTAATAAGCCCATTTCCAGCTTGGAAGGATCATTTATGGAATTATTAGGG
CCTAAACAGTCAAAAGTACTAATAGAAATTTAAATTTGGGTTTATCTGTTTTGACTACCC
CAAAAAAGTAGAATTAAGCAGAAAGTACTTTGTTCCTTAAAAAATGTGTTAACAGAAAAT
TGTTCCAGTATATGGCCTCGGTTTTAGTAGTTTTTATTAAAAAGTTATTCTGGGAGTCAG
GAAGGTCACAAATATGTTTATGGTTTCTGACAAGAAGGGGAAAACATCTTACTGGATCGT
TCTTACATGTAAGATGCCAAACAAGCAGATTCAAGTACAAATGAGCACTCAAAATATTTT
AATTTCCCTGTGCAACAGAGCCTGTGACGTGAAGATGAATGAAGGTTGTCCTGTTTTCCA
GAAACCACTTAGAGGATGGCCGTGATAAAACACTAGGAGCGTAACTGCATGTAATGAGGT
ACCAAAAGTTCATGTTAATTGTGCTTTTTTAAATGTATTTGTGGTACTGTTATGAAGAGC
AGTACCAAAAATGTTTAATACATTTTTTACATAGGTTAAAAACTGGCACAATGATGACTT
AAATTATTTTTTGCCGTTTACCCAGCTGAGGGTTTCTTTGAAGAAATAATTTTAAGACTG
AGATGCCAGTAGCCTATAATATTTATGTGAACTACTCAAGTATGATACAATTTTTTATTA
AAATGAGTGGGATCCCTGGGTGGCCCAGCGGTTTAGCGCCTGCCTTTGGCCCAGGGCGCA
ATCCTGGAGACCGGGGATCGAATCCCACATCGGGCTCCTGGTGCATGGAGCCTGCCTCTC
TCTCTCTCTGTGACTATCATAAATAAATAAATTAAAAAAAATTTTTTTTAATGAGTGAAA
TGTTCTTTTCAGCATATAGGTAGCTGCAGATGAATATTCTCATCCATAACTTTTGTGATT
GAAATTCTTCGTTGCTTCAAGTAAGTAATTAAAATTTGTCACGCAATCACAGCTACTAAT
AATTCAAAAGGATCTGAACAAAGGGCTAGGGCCATTTCCTGTTAATGTTGCCTGTGTGTA
TCAGGAGTAAGAGTTCATTTGATTTTGACTATGGAATGATTTTCACTATTGGTTTCTGAT
TTTTTTTTTCCTAGAGGCATGCAATTGGAAGGAAAAATGAAGAATTGGTCAAGAAGAGAT
GAATCGAAACATGTTGAAAATTAATATTTTATTTAACATTGATCACCTCACAATAAGTTA
TAGAAAAATACATGTTTGAATACTTATAATTGCTAGGCAATAAAGTATTAATCTTTAAAA
TATATCAAATGTTTAAACAGTTCGATTCTTATAATTACTAGTCAGACTGTTTTTAACATA
CTTTAAGGATAGTATGTTCTTGTCAATAACTAGCTCATTTGTGGAATGACAACCTTTGAG
GGGGCAGTCAGCTGGGGAAACAGTCCAGTACCTCCACTTCTCCTGCCTTTTCTTGCCTTA
GGGGATTTCAGCAAACTAGATAACCATGGACACCTCCCCTTAAGAACCTGCTACTATACC
TAAAAACGAGTATTTAGAATCTCCTAACCACCTTAATGAATTATCCCTTACAAGTAAAGA
TTATACCTGTGACCTACAGAGTTTAAGATTAGATCTTATTTTATTCTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved