Canis_familiaris Locus Mono:155:SNORA7
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:155:SNORA7
Canis_familiaris
Mono:155:SNORA7
18
SNORA7
1001..1121
2121
AATATGTTAGCCCATTAATAGAAGTACTGTGCCCATATATAGCTGATGTGAGCTTTTTA
TCAAGGACAACATATGAATCAAATAGAAAAATATTTAAATTCGAATAATGGTTCAAGTTT
TTAAACTAGTTTGTAGAACCAAAGTAAAGTTTTTGAAATTCAATTTGTCAAAAATGAAAT
ATCTGTCATTATGGTAAATTTCACTATAAATCCTGTTAAAGGATTCAATATTGCAGCGTT
GCAGCAATATTTTGAATACGAATTCTGATAAAGTGAAATGCTAAACAGAACAAGGCTCAT
AATGTTTGTGAAACAGAACTGTCCTTGGAATTGGTCATGGAGCATAAAAGTTAATACAAC
TCTAACAAGTTAAGAAACTGGTTTATGTACATTTAAAGTACTCAGTGTTATTGTAAGTGA
ACTATGAAATTGTGACGTTGGTTTACATACAAAAGGAAAACCCCTTGGCCAGGATAGTGC
CTTTTTTTCTTTGGCGCCACCATTACTCACACCATGGAAGTGATTTAAGGTTAAGAAATG
GCTGTAAAACAAACTAAGGAACCTACATGGGGTCATTAAGTCTGTCAACAAGGACTATAA
ATTTGGGTGATGTTTCATGCAAGATAAACTGGAAATCTGTAACCAAAAGTATTCAACAGT
GGAGTGCTAAAAATCTGTAGCATTTTGTATTTTAACAAATGGAATTATTAGAAACATAGC
TGATGCAACGTGAACACCGATCCTGCGACTATATCTTGCTCAAAGTCGAAAGCAAAGAAA
AACCTGGGCAATTACATTATGAGAGTCTAAACAACAGACTAGATTTAGTTTCAAATATCT
GAAATTGTGTTTTGTATTACCTAGGTATGTAGAAGCAATATTGCCATAGAGCTCTCATTT
TTATTTTGGATAAATTCATATTTTCTATCAGATTAGAATGAAAGGGAGAGGTTCCACAAT
GTGAACCCATCTCAGAACATTCCAAGGAATCATGAGAAGGTGACCTCCCAGGATGGCACC
TTAAGATTGCCAGCTTTGGAGATGGGAGGGGAAGCAAGCCTGACAGAGGTTCCCATTCCC
AGCTTGCTCAGTAGCTGGCAATTGGAAGACACTGCAAAAATGTTCAAGCCCTGAGCAGAA
AAGCCCCCTCCAAGACTCTTTGACACCATCTCAGCCTCTTTCTTGAAGGCATCATGGCCA
CTCTCAGACCTCTGATGAAGCCCAAGAGCATTAAAAAAAGGACCGAGACTTCAGCCAGCA
CCAGTGAGACCAATAGGTCATAATTAAGTGCAACTAGCAGAAACCCAGAGGAGTTGACAA
CAGGGTGCACAGAAGATGCAAGGGCCAGATCTTGATGCCCAACACTGGTCATGGGAGAAA
CAAAAAAGCAAAGGACATGAGTCCCAGTGACTTTCAGAATTTCCTAGTTCACAACGTCCA
GGAGCTTGAAATGTTGCTGATGTGCAACAAATCTCATTATGCAGAGGTTGCTCACAATGT
CTCCTCCAAAAACCACAAAGCCATTGTGGAAAGAGCAGCCTAGCTGGCCACCAGAGTCCC
CAGTCCCAAGGCCAGGCTGCACAGCAAAGAAAATGAATGGACAGACAACATGTGTGCACG
TCATCATTTGTGTTAATATAACCATAAAACTACCCAAAAAAATCATGAAAAAAGATGATT
TATTTAGAGTCCTGTTTTACAAATCTTTGTTAAAGGAAAGTACTCATGAATAAAGGCAAA
AAGATGATGCCAAAGAAAATATTTAGGCTTACATACATACCACTTTAACACAACAATATT
AGAATATTCTCTATTTAGCAGAATTTACTCAACTACCAAAGGTTTTTCTCAAGTCAAGTA
TGTTCTAAAGCGAAAAATCAACTAAAAGTGTCACCTCACATCTATCAGAATAGTTAAAAT
CAACAACATGAGACTCATTGGTGAAGATGTGGAGAAAGGGGACCTTCTTGTACTGCTGGT
GGGAATGCAAACTTGTGCAGTTTCTCTGGAAAACCATAGGGAGGTTCCTCAAAAAGTTAA
AAATAGAGCTACCTTATGATCCAGCAATTGCGCCACGAGGTAGTTATTCAAAGAATACAG
AAACACTAATTCAAAGGGATAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved