Canis_familiaris Locus Mono:57:SNORA1
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:57:SNORA1
Canis_familiaris
Mono:57:SNORA1
7
SNORA1
1001..1139
2139
ATATTCTGAAAATTAAAAAAAAAAAAGATTAAAAGCCATTTCCCTTAGGGTTCAAGTTT
AATTATTATTAATGTCTTCATATAAGATCCTGTCTGTATAAATAAATAAGTATATTGTTT
TTCATATTTTCCTTGCTAAAGTATGATAGTATACTTAGTAAATATCCTTATTTCTGCTCA
TTGCCAACATCCATCACCACTCCAAGATAATATTCTTGCATTTTAAGTTCTCAATTTTGA
GATTCAATCCTAAGAAATGAATAACCAGAGCATTCCAAGGCCTTTGGACAGCCCACTTTG
AACAGTGCTTTGACTTCAAGCCCAGAATCTATCACCAAATCCTCAAACTCTATCAATCCT
AGAATTAGTCTTTTAAAAATTATTTGGTAATGAGAAAACATGAGACATTCTTTAAAAAAT
CAAAATTTAACTCAAGTACATAAATTGATCATTCAATTTCTAAAAATAAATTTTAAAACA
ACTTTTAAAAAAGTAAATTAAAATTGAAGTAATTTTTTTTTATGATAGTCATACAGAGAG
AGAGAAAGAGAGGCAGAGACATATGCAGAGGGAGAAGCAGGCTCCATGCACAGGGAGCCC
GACGTGGGATTCGATCCCGGGTCTCCAGGATCGCACCCTGGGCCAAAGGCAGGCGCCAAA
CCGCTGCGCCACCCAAGGATCCCAAAATTGAAGTAAATTTAACTTGAATATTTTACCTTC
TATTTGTTTCCTACTGGCATTTTAGATTTTTAAGTAATCTGGGGTTTACTATAGGAGTAA
AATAATTTCATTTGAGCAAGAATTTGCATTAAATGCAAATTAAATTTCCTTTGTTCTTTT
TTAAAATTTAAAATGAAATATAATTTCTCATCTTATTGAAACATTTAGAATAAATTCAAT
AATAAATTAGCATTTCTCTCTCTATGTTTCATTCGTCAACAAATGTTTTTCAAGCTCCTT
TATTGTTCAGGATATGGCATGGGTTATGAAGAAACATTCAAAGCCTTATTCTAGATGGAA
ATGGGCACTGTCATTCATGGTGTCCAGAAATTGTTAATGTAGGTACATTGAGACATGGGT
TATGCTTCCATTACAGCAAGTTCATTGCAATGGTGAGTTACAATGAGACCTGTAACATTT
TCTGCTAGGCTCATGGAGTAGAGTGGAAGAAGACTTTCATTAGGAACAACTAAGGAATAA
TAATCTTAGATCATTTGCCAAAATAGCAATCAATGTACTTCCTGCAATTTGACTTCTAGA
GCCATAAGAAATTGGTAAAGATTACAGGTTGGGAATTTCTGAAGTATATCCATACTCAAG
TGGAGGTCAAAGAAGACCAACTGAAAGTACTCTGGACTGACAGTGATAACTGGGGATTGA
ACAAAAGTTCTTTTTAAAGGGCTATTTTGAAGATTATGATTCTGACTTTGGAGAAACTAC
AATGATTGGCAGTGGAAGGAATCACATGTAAAATTACTTAAATAAAATTTATTGACTTTA
AATTTTAAAAATATTCAAAAATATAAAGATGTATACAATCTTAGTCTTGCCCTCTGGGTG
CTTATAATCTTAAGAGATGTTTGAAATGTTATACACCAAGAGTCACAAAGCAAAGCCTTA
AGAGTGTGATAAAGACAGTAGGTTGAATATAGGCTCATTCACTGACAGCTCTTTTTGTGT
TGGGATGTGCTAATGTAATGCACCACCAGAAATGTTACCTGATCAAAATCATAATGTTCA
ACATCTAAATTTATCATTCCGCATTGACCAACAATTTTAAAAAATATGAATAAATTTGAT
AAGATACTTTCAGAATGCATATGTATGGCATGGTAAATGCATGTTAAAAGTTTCCAGTGA
AGATTTAGTCAATTCATCCACCCATATGGTTGAAACATTTACCAACTTTATGCTTTGTTG
GGAAATGAAGGAGGAAAGAGGGCCAAGTGTATGACATAGATCAAGTTCAAAAGATTCATG
AGATTTATTCCAGAAAAATAAGTAGTTCCAAGAAAAAGGAAAAAAAAGGAAAGTTTCAAA
ATGAATTTCACTCTTGATACAAAGGCAAATAATTATAGCTTATATTTCTTAACCAGCACC
TGCTGTGATATAGGAATTACAGAGTCCTATGAGTCTCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved