Canis_familiaris Locus Poly:18:SNORA16
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:18:SNORA16
Canis_familiaris
Poly:18:SNORA16
2
SNORA16, SNORA44, SNORA61, SNORD99
1001..1135, 1628..1758, 1976..2108, 2931..3010
4010
TCCCCCCACCCCGCCTTGGCGTCGCCGCCATTGGCCCCGCACGCACCGCAGCCTCTGGC
CGAGGCCACGGGATGTTGGGAGCGGCTCGGAGCTGCCGGGCCTCCCCGCCTGCTGGGACT
AAGGCCCGGAAGGCCGGGTCGGCCGCATGCGCGGTGAGAAGGGCCGGAGCCCGGCGGGGC
CGCACATGCTCCCGCCCCGGCCCGCGTGTCCCTGCTCTGCGGGGCGACGGGTGAGTAACG
GCAGTCCTGGGCCTGAAGTGGCTTAGTTGGGGAGACGCCGCTCTGGGGTGTTCACCAGGA
CTTCAGATCTGAAGTTGAATCTGCCGATTACAGCTACCCGTTGGGTGACTTTGGGGAAGT
AGCTTCACCTGTCATCTGGCTGCACAGCAGGTTGAGGAGTTCATGCAGGTGGATTAAACG
ATAGGGTTTCTAGGGGTCACGTTTTAGAGCCCTTGAGGTCCTAATTAGTAGATAACTTAA
TTGGTCTTAACGTATTTGTAAGATAAATGGTCCTGTGTAGATTAAATGAGACAAAACTGG
TACATAGTAAAATAAAAGTGGTAACTGGGACTATCTGTTCTCAGGATTCCTCGCTGACTC
TGTCCGTAGAGCATGTGACTTTTTTTCCCCCAGATTTTTTTGAGGGAGCACGGGGAGCCC
AACCGGAGGCTCCATCCCAGGACTCTGGGATCATGGCCTGAGCCAAAGGCAGCCACTAGC
CACCCAGGCGCCCCAGAGCACGAGACTCTTTATCTCAAGGTTGTGAGTTGATCCCTAAAT
CTCGATTTAAAAAATAATTTGTCTTTGTCTGGCTGGAACTGAGGACGGGAAGATCAAGAC
TTAACCTGAGCTGAGCACCCCCAGGCGCCCCAAGGGTATCTTCTCTTTATTTGGTCGCCA
GTATATTTCAGTAGATAAATTCCAGTTGGGCAGTAGTGCGTGGCTTTTATGGGAGTCTGA
CCGTTGGACAGCAGTTGGGGCGGTCTTGGGACCTGAATTGCCCTGGCCCTTATCGAAGCT
GCAGCTGCTTCCACATAGCTGCTGTGGTCAAAAAGGAGCCCAGAGTGACAGTTTTCCTTG
ACGGTCGCCGTTCTGTTTGATGTAACTGATCTGCAACATTTCAGGAAAAGACAGTTCCTG
TTGAACCTTCCATTTCTCAGGTATAGGTGGAGTCCTTTATTAAAATCGACAGGTTTCCAG
AGGCTAGCAGGAACATTCTGTTGATGGGGCCTCGCATATAGTTATTGTCAAAATAAAACT
TTTGGGAAGTAAGTTGCTGAGACCAAAAGCCAGTATGGAGGCCAGGGGAGCGGGTTGGAC
AGGTGTACTGGGAAAATCTAGAGGCATGTGGCACAGATCTCAGCAGTGCTTTGGGTCACT
GCCTTGAACGGTGTAAGGCATAAGTACCAGGTTCAAAAACCACACCTTGGATTCTGAAGA
CGAAGACCATGAGAAGGGAACAGTAAGATCATTCAGGACAACTGTTTTCTCATCTTAGCT
GTGCCGGCTGAAGATTCCAGGATGACTTTGAAGTTGAGCTTTCTGGTGAGGATTCTGGGG
TCATGACTGATGGAACACAACCACCTCGGGACCTGGTAGGTCTCTGGGAACTACCTGATG
GGTCAGTTCAGCATGTTTCCAAGGGCTGTGGCCGGTAGTGGCCATGGGATCTCCAACTGC
ATGCGAGAGCAACTTGGAGAGACTTTGACAGCACAGGTCAGCATAATACCTGCAGCTGCC
ACTCGCCTTTCCTATAACCACTCGGGACCTGGGCCAGAAGCCTTCTGCCCCAGTCTAGGT
GTTTCTGTAAATGTCCATGTGGTTGGGTGTACTGGATCAACTTTGTTTAGAGCTTTCACA
CTTTTCTCTGCAGGCTGCCCCCAAGTGTCCTGGCAGCGTCTGTAACTGAAGAATCCAAGG
ATACCAAGGTGTTGCTGTCCTTTAGACAAGGTAAGTTAGATGTTGAAGACAGCCTGACCC
TCCGGTTCCCTTTCCCATCGGATCTGAACGCTGGTCTTGGTGGTCGTAAAAGGAGGAAAA
GGAAAAGTGAATCTGGCCCTGCAGTGCTTATAGTCTGGTATATAGCTTGTGGGCTAGTTT
CAAACAAGGTTTGAATTCTCTTTAAACTGGTTTCCTCTTCTCTAAAATGTGATTGTCTTA
GGCTCTTTTTTTTTTTTTAAGATTTTATTTACTCATGAGAGACAGACCTAGGCAGAGGGA
GAAGCAGGCTCAATCCCAAGACCCTGGGATCATGACTTGAGCCAAAGGGAGAGGCTCAAC
CACTGGGCCACTCAGGTGCCCCAATAATCTTAGGCTTAAAGGGGGGATGTATGTAAAGCT
CCAGGCAGCTGTAGTGCTTGCTGACTTAATTCTGTGTTTGATAAATATCAATGGCTTTCT
TGTCTCTTGATTGAGTGTCCTTTTCGGTTGCGGTTTTTTTTTTTTTAGATCTGTTCCCAG
TAAAGTTGCCCTTGTCTGTGATTATGGATCCATAGTCGGGTAAGTTGGCTACCTGAAACT
TCCATAGCTTCCTTGCAGCTTTGAGTAGTGCTTGAGCTTTGTGAATCCTGAGTAGTGTAG
TGAATCAGTATAAGCCTACTCAGGCCTTCGGGAAAGTGTTAGCTTTTTCATACATCATTT
ACACCTGACCTCCCTGTGTGCCCTACTGGCTGTTAATAGCCAGAAGATAAAAATTTGCCC
ACTCTGTTGGAAGGCCAAGAGCACATGTGCTAGGAGTAGAAGATACCAGATGCCAAAGCC
CTGCACCTTTGGTGGCAAGGGCTGGTTGCTGTGAGTGTACTGTAGTGGTTTGAGCTCATG
CTGAAGTTTGGGGAAACCTCAAAACATGGAATCTTACTGGCCCCTGTCCTGGGAGAATGG
GAGATGGGTTGGGTAAAAACAGATAGTTCATCTAGCAGGTTTTTTAGGCTGACTGGTCCA
GGATGAAACCTAATCTGAGTGGACATCTATGGATGATAAATGCGGATATGGGACTGAGAC
CAGCTCTTCAGAAAAACCCAGCGTGGCATTAATTAATTGGGGATGTTAACACGCTGGCTT
ATACTTCCTTTTTAGGAGAGAAACACTATGGGATGAGGCAAGTTGAAAGACAACAGATGA
TTTTAGTGAAGAATCACGACCTCTGTATTTCTGTGAATGCTGGCACAGGGCATGTAAGTG
ACCAATAAAAAATTTGGAGTATGTTTGTGTCTTGTCTTTTTTTTTTTTTTTTTAAGATTT
TTAATTTTCTCTATTCAGAGACAGGCACAGGCAGAGGGAGAAGCAGGCTCCATGCAGGGA
GCCTGATTGGACTCCATCCTGGGTCTCCAGGATCACGCCCCGGGCTGCAGGCGGCACCAA
ACCACTGCGCCACCAGGGCTGCCCTGTGTTTTAATGTCTCTTGAATTGCTGGATATTCCA
TACCATTACAGTGTCCATCTTTCCATAAAAATAGGTTGACCTCTCAGGACAATATGATCA
ATTCCATAACTGCCATCGTATATAATATATCCTTTAATAGGCCTGAAAATTCAGGCAGAG
CCTAAGACATGTCCCCTAAAACATCTGAAGGCTTTTTCTGACTTAAGCTATTTATCTTAA
GTTGCCCTTGTTGTGGCCCTTCCCCGATATACAATTTCCTGTTGCACAGAAGTAGGGAAG
TTCTGATTTTCCACATGGGTACTGGAGAAATTCATACCCATCAAATGAAATTAAGGTCAA
GAAACAGGTGAGCCAGGTACACAGAGGTCACAATTAAGACCCTCAACATGGGTTTGTCTG
AGTTGCTCTGGGAGCATGCCCCTAAGTCTAAAGCCTTCTAGTCTAGATTTAGCTGGTTCC
ATGCAACTTCCTTCCCAGCTGGAAATCTAGCCTGCAAACTTGGGGGGGGGGGAGCTCTGG
GTTAAAAAAAAAAAATCCTAATCCACTTTTATTAATAACCCCAAACTCTCCTTTATCTCC
AAGAGAGTATAGATAACTCAGCCTGGGAAGTTGTTTAAATACAATTAGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved