Canis_familiaris Locus Mono:77:SNORD116
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:77:SNORD116
Canis_familiaris
Mono:77:SNORD116
3
SNORD116
1001..1081
2081
TATTGAAGGGGAGATCCTAGTTTCAACATCCAATGCTGATGGAGGCCGTTTGAAAAATC
TTTGAGACCAAGATCTTGTTTCAAGTAGTGAACATAATTTTTCTTGTTATTTAGAGAATC
AAATGAATACCTTTGGTTTATTTCTTATAACTTTTTATTAGTAAACTTTCAATTATAGTG
GTTTGGTTTGTCAAGTTTCCTAATTTCTTGGTATATTTTGTAGATTAGAAGTGATATTGG
AATTGGTTGGAATTTCTACCACTGCTCCAATGAACTACTGATTTTGTTATTGTTGTCAGT
TCTTTTCTATGGGAATAATCAACAGTGCACTCCAGAGGTAACATTGCAACTTTAAAAAAA
TATATTATTTAGATTATTTCTATTATATATCTTTGGCAAACAAGATTATACATGATTTTG
AATAGTCTCTTAATCCAAACAATGTAAGGCCTTTATAATCTAGGTCATCTGAGGTTTCTA
TGTACTTTTCCTACAGAATTTGTATGCTTCCTCTTTTAAATAACATCAGAAGAGCCGACT
TGAAAATATTATTACGATATACTTATACATAATCAATCTCTTGTATTGTGCATGATACAG
ATGGACATGTATAATTCTCATCTTTCCACAATTTTATTCTATGCTAACATCAACATGGAC
TAAGATCTTGGTTTCATATAAAAGCTTTAATTTCTTCCCTTTAAGACATAAAATGAAGGA
GAGTTTTGGGAAGAATTCTGTATCCCCTCCTCATGGGCCAGTGGGAAATTTTACACTGAT
AAGCATTTTTTACTGAAGACTGTAACATTCCTCTCAGGGAATTATAACACTCTAATGACA
AGATTTTGGCTAAGCTAGTCAGCCATAGGCTGAGTTCTTGACTGTAGTGACTAGTCTCCA
TAATTGAATAGTATGGTTCAGTGTATCCTAGTGAGACAGAATCCTGAGTGCTCAATGTCT
GCCATATATTCAGGATTAAAACTCCTTTTGCAAATGTAGTTCGATCAATGTGGTTTCAAA
AATGGGTCTTATCGAAATCTGAACAAAATGAATGACAAAGTCATTTCTGTAAGCTAAGGT
CCAGCACAAGGACCACGATGCTAGGCAAAAAATGTGAATGAGAATTCAATTTGGTCAGCA
AGTGGTACCAAACAAAAAGGACTATGGCATTGGAAAACTAGCATGTTGGCAAATACTAGA
AGTATATTATACCAAGGCTATAAATAACCATTGTGGAATGACATGGCAACTCTGAGTACT
TGATTGGTGGCCTTCATTTTTTTTTTTTAATANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTTGTGCTTCTCTGATTGACTTATTTCACTCAGCATAATACCTTCCAGTTCCATCCATG
TCAAAGCAAATGGTGGGTATGTGTCATTTCTAATGGCTGAGTAATAGTCCATTGTATACA
TATACCACATCTTCTTTATCCATTCATCTTTCGATGGACACCAAGGCTCCTTCCACAGTT
TGGCTATTGTGGACATTGCTGCTAGAAACATCGGGGTGCAGGTGTCCCGGTGTTTCACTG
CATCTGTATCTTTGGGGTAAATCCCCAGCAGTGCAATTGCTGGGTCATAGGGCAGATCTA
TTTTAACTCTTTGAGGAACCTCCACACAGTTTTCCACATTGGCTGCACCAGTTCACATAC
CCACCAACAGTGCAAGAGGTTTCCCCTTTCTCCACATCCTCTCCTACATTGTTTCCTGCC
TTGTTAATTTTCCCCATTCTCACCAGTAGGAAGTGGTATCTCATTGTGGTTAAAAGCCAT
CTATGAAAAGCCCACAGCAAATATCATTCTTAATGGGGAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved