Canis_familiaris Locus Mono:87:SNORA44
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:87:SNORA44
Canis_familiaris
Mono:87:SNORA44
12
SNORA44
1001..1134
2134
GCAGAGGAGAGGTGTTGAGAGTCTTGGCTTCCAGCTTTAGTTCTTCTGTACTCTTACAG
CTAAAGAAATGCATGACTGCTAATAGCTGAAGAAGTTTCAGGTACCTCCCTGTCATTCTT
TCTGTTAAACTTGACTCTACATAAACCTAAACTTCATTTGAAATTTTAGGGAACTGTCTA
GGCAAGGACCTGGTATGGTGAAGGGCCTGCTTGAGGGTGGGGCTGGTGGAATGGATTAGC
TTGAAATTAGGCCAGGCTGAGATCAGAGTAGAGAGCCTTGGAGAAGCCATTTAGGTTTTG
GGTAACTGAGAGTGTTTTGACGTTTTTGAGGAAGAAAAATAAAGTGTTATCTGTAGAAGG
AAGGTTTCCCTGGTAGTGGTGAGAGGGTTCACCACAGAGTACCAAGACAAATTAGGAGGG
TCTTCCACAGAGCCTGCTATGAAATACTAGACCTATAGCATGACAGAAGAAATGAGAAGA
GGGAAGGGAAGCTGCACAAGTAGAGACAATATAACTAGATGGCTGATGGAGAGAATTGGT
GAGGGTGATAGGTATCTGGGAAGATGTTAGTGACATTAGCCATTAAAAATACAGAGCAAT
GCCCAGGCTTTTGATTGCTAGATGTGAATGATATAATGAATGCAATTTTGGATATTTTGT
ACCAATTAAGTAGGACAGCACCAGTCGTACTGGTTATGCCAAATTATTACATTTAATTCA
TCTCAATATATATTTCTAGAGTTCCTACCACTTGCTAAGTGTTAGAAGTCATACAAAGAT
GAGTAAGACAAGAAAAAACAAAGATGAGTAAGACAAATATTGCCTCAAATAGCTTTCAGC
TTGATGACAGAAATAAAAAACAACAATAAAAGGTAAAATACAATATTTCATAAGAGAGGT
ATAGGAACCATCAAGACTTGAAGAAGAAAAAGCTTATGGTCCTTTAGGGGCAAGCTGTGA
TGGTTAGGATATATATATTTTTAAATTAAAAAGCATTTTTTCAGCATATTTCCAAGGGCT
ATGGCCAGCTGTGGCCATGGGATCTCCAACTGCATGCGAGAGCAACCCAAAGACACTTTG
ACAGCACAGATAGCATAAAGCCTACGTGCAGCTGCCACGCACCTTTCCTAGAACTGCTGG
GGGTGGGGGCATTTTTTCCCCGCAAATGCCAAAAATATCCAATGAAATAATTAAGTTCAG
AAACATCTAATAAATGTGGACTCAAGTGCAGTGATTATACTATGAAAATCTTAGTGAATT
CCTTCCAGGGGGATGGCATGAGATGCTGTTTACCATCCACCTGGAGTTTCCTTGGTGAAA
TCTGAAAGCAGCTGAAATCTGAAAGCAGCCTCTGTACTCAGAGGGCAGGGAGAGACGGAA
GGAAGAGGCAGGCCATTCCAGGTTGGTAGATGGCAATTTTAATAAGCAAAGGGAACTTGT
ATACTAGGCTTATCGTAACCTGTAGCAAGATGAGGAAAAAAAAATTTTTAGCAACAAAAA
CCTGTTTTATTTTTTCCAAATACAGATACAGAAGTTTGCATGTTTTGCAAATATTCCTTC
AAAGCAACATTTCTTATACAGTCCCTTTGTTCTAAAAGCTCGACATAGATATGTATCCAC
AGTGCAATGTTGGCTTATCGAGGATCCACCTTGCATAACACTCATCATTTAAAAAGCCAA
AATGATTAGTCGAACCAGAACTGTTTTTGTCAAGGCAATTTTTTTTCGGTGGATAGTTTT
TCTCTAAAGAAAATTTAGGTAGTATACATATTTCTAAATGGTAACAGTAATCTTTGCAAA
TAATAGTTTCTAGGGCTCCAACTTGGGGTTAATTCAACTTGACCCAGAAATTGGGGTTGG
AGCCCCTCAAGATGGCTTTAAATTAGAGAGGTACATTGAGGTTATGAGAACTTGGAGTCA
TCCCTGCTTCTCTAAGGACAAAAGTCACAATGCATGAAATGAGATGATTTTCTTGACAAA
ATTTAAATACTAAACCCAATAATGGCCACTTGGAAAAATTAGGGTAATTCAGTTTCTGCT
TCCATCTTTGGAGAATACATGAGATTGACTCCCTTAGAATTGTAGTTTTTCCAGTTGTGA
TGCTCAAATATATTTTCAGAAAAGAAAAATCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved