Canis_familiaris Locus Poly:16:SNORD50
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:16:SNORD50
Canis_familiaris
Poly:16:SNORD50
12
SNORD50, SNORD50
1001..1070, 1328..1397
2397
GGCTGCGGCTCGCTGCGAGGCTCTGGTCAGCTGTGCCTAGAGCGCTGTGGTTTGGGAAG
CCGCACGTGGGAAGCACGCAGCCGGGCCGCCACGTGTCGTCCGCGGTGGCGGTGGCGGTG
GCGGCGGCGCCAGGCTTCGAGCTTAGGCGTGCGGAGGCTGGTGCTGAGGGCCACGAGCTC
TGCGCGCGGCCTTGTTGAGCGCCGACACCCGACTGGCCGAGCCTGGGCAGCGGAGGGATG
ACGACCGTATTCCCCGCGATTTGGGCCAGGGAGTTAGGTCTACGTTGAAAATAAGAGACC
TTTACTACTAAGACGAGTGTCCCTTTATCGTCGCAAATCAAAAGGTTACTTGAAAAAATG
GGCGGTCCCCGACCTTGTCTGAGATGGACTTGTACTGTGCCCAGGTGGCGCTGTGTGCAA
GGCAGCCTAGTCAAAGAGGCAGGGTTCTAGTGCTGAAAACCTCCAACTGCCAGTCTGTGA
GAATGCTTAGTTTTCAAAATATTGGTCCTCTGCAGGAACAATGGCTCTCGGTGGTGTAAT
GAAGCTGCTCTCTGAAGATGATGAGGTAAGTACGGTGGAGAGCTTCGTTTTTAAATTGAA
GTAAACCTGTTGATACGCAGGAAAAGATGATGCATCATCTGGAATTTTGCTTCTTGATAG
ATGCAAAGGAAAACTCCAACAAAACACGTGAGAGAGTATTTGCTGGGAAATTACTTGGTC
GAAACCTGACAGTCTTAACACAGGTATGTGTTGGGCTAATACTTGAATTCAGTAGGTTTA
CTCCGTAATGTAGATTAAATGAAAATTTTATTCTTGTTCTTGAACAGCTTCCTGGGGATT
GATAATAATGGACCTATAGATGTCACTGACTAGCAACCTCATTTTTAAAGTAAGTTGTGT
GGTGTACAAGATAACACTACAGTATTTCCAGCACCGTATTTACCTTTTAACATGCCTTTG
GCTAATGGTTAATTTCACTGTTCTATAATGAATTCTGGTCTAATCAATGATGAAACCTAT
CCCGAAGCTGACCACCTGAAGAAAAGCATATACGGATTCGGCTTCTGAGATGAGACCAGA
ATAAAATCTGTTCTGTTGTCCGGATTTTATAACAGTTCTGTTAAGTTACAAATCTTGTAG
GGGGAAAACTGCTACCTCACAATGATGTATTGGTGGGTTTTTGTTTTTCTTTGCCAACAG
TGTGGTGGGGTCGCTGTCTGCCCATGGAAAGAGGCCAGTTTGTTGGAACCTTCCGAAGGT
GTAACCCATCCCCGTGAGTGGAGTTTTTTTTTTTTTTGACATTTGGTCATTGTTTTGTCC
TTGGTCTTAATCTATGATGATCTTATCCCGAACCTGAATACATGTTGAGAAAACCAATAC
GGATCTGGCTTCTGAGATAGACCATTATAAGGACAAAGATATTTTTTTAATTCTTTCGCT
CTTCTGTCTTCTGATGTGGATTGTCTTGTAAATCTCAAATGTTTTTCCTTTTCTAGGGCT
AATGCCACGAGATTTACTTGTATGAAAAACTGATGAAGAACAGCTCCTTTTACTGATATT
GAAAGAAAACCTACAAATCAAGACAACATATTGATTTTTTTTTTTTAATTTTTGTAAACA
GATTATAAAGCAGCATCTAATCTAATGTATCCATAAGAAGCAATTCCTGGGTGGCTCAGT
CGGTTAATTGTCTGCCTTCAGCTCAGGTCATGATCCCAAGGCCCTGGGATCAAGTCCATC
AGGCTCCATGCTCCAAGTGGAGTCTGCTTCTCCCGCTCGCTCCTCCCCCTGCTTGTTCTT
TGTCAAATAAAATCTTTTCAAAGTAAATGATTGTAATTAAAGCGGAGTCAAAATTTATGT
TGAATATTGTGGGGAAAATCCATAGGTTTTTATGGAGAGCTGTGGTTTGACAGTATCACA
AAATAAATAGAAATGTTAACTTTATGTGGGATATTAAATATTACTGGGTTAATGGTGAAG
AAAACGGAGAGACCGCCTATTGGAGAGAAACATGCCAGTTATCAATGATCCGTCTGATTA
CTGAATCCTGAAATATTAGGTCTTGATGCAGTTGTAATTTGAAAGGATCCACAAAATGGA
AAATGTGGAATAAAAATGAGCACAGCCTAACAATTATGGGTCATGGGGGAAGATTGCTGA
TAAAATCGGAGTTTAAGCTAGTCAAACATTGCACAGAATGGATTTAGCGTAGATCATAAT
AGCATCTGATCTAACCAAGATGGTCAGGCCATGCAGGATCATTTTCCCTAAATAGCTGCA
TGAATAAGTTGTTCCCAAACCCATATGTGTCAGTCAAAATAATAGGGTTTTTTTCTTCTC
AGCTTATAATGGGCTGTATCTTTTTCCTAAAATTGTCTGCCTTAGTAAAATTTAAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved