Canis_familiaris Locus Mono:91:SNORD81
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:91:SNORD81
Canis_familiaris
Mono:91:SNORD81
37
SNORD81
1001..1073
2073
ATTCTAGGGCTGTAACATGAAGCCCGTGTCAGGCTCCACACTTAAGATTCTCTCTCTCC
CTCTAACCACCGCCCCCCATCGCCTCCCTCTCAAAAAAAGAAGGAAAAAAAAAAACATTA
TTTTGTGGGAAAAGTGTATTATATAATCCTTCATGAAGCATCTGTTTTGATTTCAACAAA
ACAAAGTTGGGGGCAGGAAAGTAAAGTTTAATTTCAAAAGCAACTACTGAAGCAAAAGAG
AAGATAAAGTAAGAAGACAGTCAAATGTTACAATATTTTATTGATGTAGTTGAGGAGTGA
CCATAGCATTTTGTACTAAACAGATTTATCAGTTGTTTCATGGCAAAGTATTTAAAAAGA
GATGTCAAAAACTTAAGAATTTATCTTTTACAAAAAAAGTCTAAATTTGCTGACTTTCTG
TGGTAACTATTAGTCTTATGCTACGTAGCCATTGTTTTTAAAAACAAAAAATTGGTTACT
CTGTACCTTAAAAATAAATGAGACATTTTAAAACTTGGCAAGAAATAACTGTATTAAAAA
AAAAAAAAACACAAAAACAATGTGTCATCTTGAACTACTGTACCTGATACTATAAAATCA
GAGAAACCATTTTCAAACTCTCAAACTCTAAGTGCTTTTCAAAACAGTTTTCTATGGATT
TTGAACACACTGATTAAAAATATATAAATGCAAATCCTCACATTGGTTTGCCTAGGAAAA
GCAAACCCTACTAGCCAAATCTGCAAAATTGGTGTATGGAAATTTTTTTTAAAGATTTTA
TTTATTTATTCACGATAGATATATATATATAGAGAGAGAGAGAGGCAGAGACACAGGCAG
AGGGAGAAGCAGGCTCCACGCAGGGAGCCCGACGTGGGACTTGATCCCGGGTCTCCAGGA
TCGCGCCCTGGGCCAAAGGCCGGCACCAAACCGCTGAGCCACCCAGGGATCCCCGGTGTA
TGGAAATTAAACAATGATTGTCTCCATTAAGAAAGCATAGCCCAAATACATGATGATCTC
ATTGCAACTTGAACTCTCTCACTGATCATTTGATGATTAAAAAAAAAAAAAAAGAAAGCA
TAGCCAAATATGTACTCACTCTTTCCAGGTATATATCTCTATATGAGCTGCCTTTTAATT
AAGACAAACATTAAAACCAAGTACCAAATTAAACAAATTCAAGATCCAGACTTTGGAATT
TCTTTATTTCTAAGTAGTAAACCCAAGATTTTTCAAACATAATGCAATATATTCATTGCT
CCTGCTTTAAAAAAAAATATGTATTTATTTTAAAAATTTAGAGTAAACAAAAAGGTTTTT
GAGCCATTACTAACATTTATAAAGTACTCCATTCACAGATGAGGGGATCACTGATTCCCT
TCACTAGTCTCTATAGTCATTTGTTATAAAATAAAATAAGCCAAATAACCCAAGAAAGAA
TTAGTCTTTATAAATAAAATTAACATTATTAGATTTTAGTGAATCCTTTCAGGAAATCTA
ATACCAACTGTAAATAATTCTTCAAATAATAGTTTTCATAAAAACCTTTTTTATTGAATT
CCTATTCTATGTAAGGGACTGAGAAGCATTTCAGATGAGTGAAAGGCCCAATACTCCAAA
ATTCAGGGGGATTTAAGACAGTATACAATTATCTACAACACAAGGAAAAGCAAGGAAGGT
CTAGAGAAACGAAGAAGAAAACAATTAATTTTGCTTGGTGTCTACAGCTTCACAAAAGAG
ATGGATAAAGCTGGGTCCCAAAAGGTAAGGGTGATTTTGACTAGAAAAATTAGGGAGAAG
ACAGACTGAGAACCATGGATAAAAGCATTTACAAGTTGGGATAAAGAATATACAGTATTG
GGGATCCCTGGGTGGCTCAGAGGTTTGGCGCCTGCCTTCAGCCTAGGGTGTGATCCTGGA
GACCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTGTGTCTC
TCATGAATGAATAAATAAAATCTTAAAAAAAAAAAAAAAAAAAAAAAAAGAATATACCGT
ATTTTTCAGGTCAGATTATTAGCTGTTTTGCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved