Canis_familiaris Locus Poly:3:snoR38
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:3:snoR38
Canis_familiaris
Poly:3:snoR38
9
snoR38, snoR38
1001..1078, 1560..1633
2633
TCTGCCTGTGTCTCTGCCCCCCTCCCCTCTCTGTGTCTCTCATGAAAAAATCTAAAAAA
TAAACAAACTAACGAGAGATCTGGGCTCTAGTCTTAGCCTGTTACCAGATAACAACCAGA
GCTTTATTGCTTTGTGAAATAGGGTTACTATTTCCGGACTTGGCTATTACATCCAAACCA
CCTACAAAGTGTTACAAGTACACCTCCAACCACAGATGAGAATGACCCCGCAGTGAGGCC
CAAGGATTGTGTGGCCATCCCAAGAGCAATTGTATAGGAACAATTAGATGATCTGATCTA
CTTTTAGCTCAGAGGTTTTTATTATAGCAAGATTATAGCACTGCTGGCTATTTTTAAGTA
GCTCTTGAGACAGATCTATAATCCTCTGCTTAAAAAAAACTGATCTTGCTCGGTGGATCA
TTTCATATGCAGAGGTGAGTGAAGGAGAAATGACCTTGTGTGATGGTGCCTCTTGGCAGT
AGGTTCCTTTTGTACAGCTGGCCTTCACAGGATCCCTGACAGGAGTAACCACACATTTTA
CTGACAACTGGCATATACACTCCATATGTACTCCACTGTTAGGCATTTTGTGCCGAGGTA
GGCAGTCTTTAAAAGGGCAGGCAGTGTCCATGAGTCTGGTCTGGGTTGCTGGGTACATCT
AGGCAACTAGGTCTCACTAGTTTTTACCTTTGAAGCAAGATTGAGAATTCTCATGAGGCA
AATAAAGCAGAATTTTGTAAGGAAAAAGTAGTCTGTGTGTGTATGGTTTTTTTTTTTTTT
TAAGATTTTATTTATTCATGAGAGACACAGATAGAGAGGCAGAGACATAGGCAGAGGAAG
AAGCAGGCTCCATGCAGGGAGCCCGATGTGGGACTCGATCCCAGGACTCCAGGATCACAC
CCTGGGTCAAAGGCAGATGCTCAGCCGCTGAGCCACCCAGGTGTCCCTGTGTGTGTGTGT
TCTAGAAGCATCAGCCCTTTGGGCTGGCAGGTTGGTGGGAGCTGAGTCCATGATGATGTA
AAGTTATCCCTGTCTGAAGGCAAAGGCCTTCCTGTGGATTATGGATGTCTGAAGCTCAGT
TTCCCAAGTTCGCCTTATAGAAAGTAGAGGATTGTGATTTGAAAGTGACCTACTTGAGAA
TTGTCTGTATATATCTTGAATGGATTTTTCTTTTGCAATTTCCCCTTGCCAGATGCAGCA
GTCTCAGCCTTGGTTTCTGAGGCTGGAAAAGGATCCTGCTTCTGTAGGACCTGCTTCTGC
AGATGCCAGTAGGAGTCTACTGGGGGTCTACTGCCCTGGGCCCAAAGAGGAGACTGACTT
CTGTATGTAAGTAGAGACCTTCCAAATAGACTTGGGTGGGATGTTTATTTTGCTGCTCCT
GCCCTGGGTTTAGGATTGTGCTGAGTGGCAGGGAGATTTTAACACGGGTTTGTTTTTTTT
TTTTGCCAGATGTCTGCAGTGTGTGAGACAACTGAACTACTTTGCCTGAGGTAAGTGAAA
GAAGCCTTCCCCTGTTGCTTATAGTCTTTATGTTTCCATCCTTCGTGTCCCTCTAGCCCC
ACAAGCCTATGATGGTTTAGTTATCCCTGTCTGAAAATCTCGACTGAAGGGAAACCGTGT
ATTCTGAGGCTTCAGGGTTTAGGTCTGTGCTCTTAAAAGTTCAGGCTTTATCAGGGATTA
AATTGAGTGGATTCCAGAGGGAATCCGGTCTACCCTGCTAAGGCCCTAGTCGAGCACATC
ATCCCTCTACAACTTGCAAGCCGATGGTGTGGCTGCCCTGTCATGCTCTAGGCCCCTTGA
TGAATGGTCCTGAGGGGACAGTTATAAGAGGTGACAGAAATGGGCAGGGAGCCCAGTTCT
GGGTCATGTTCTTACTGTGGAATGAAAGAGTGTTTGTCCCATATTTCAAGGAAATGAATG
CGCTCTTTGAGACAGACGGGAATGTCGGAAGTCTGCCAGCTATGGCAGGGCTATGACCTT
ATCTCTGCACCATATCGTGACAATGAGGAAAGAAGGGCTGCCATGGCACAGCAGGAGCTA
TTTGGTTTCCAGGTGCTTTGTTTACAACCCCAGGGAGCTCTCCTAGGGTTGGCTCGGATC
CTGTCTGGGCAGCATGACTGGCATGGTGCTGCTCGTTGGGTCGCCGAGGGCTGGGTCGGC
CAGCATGTGAGCAGGAGAGTAGCCCCGTGCTGCTGGGCTGGGAGGGTGTCTGGCTTTGTT
CCCATTTAAATGCCAGGCTTGAAGTGGGCAGATTGCTCTTTTCTGTTGAAATTGGGAGGT
GTGTGTGGGCTTTTTTATATTTAAGGTCACATAATTGTTCAGTCACCAAGGAAGCCAGAT
TTGGGGTGGGATTTAGTGAGCCTGAGAACTGGCCCTGGCAGTTTACAGCCGGTAAGTGAA
ACAAAGGATGTGTTTAGCAAGTGGGGAAGTTGACTTCCGGCATTATCATCGTGCAGAGTA
GATTTGACTGTTTCGTGAGACTCAGAGACCTTCAGGTTTGACTTGAAAAAGTTTTACCTC
CAGAAAGGGGTTGAATAAGAATGTCCCTAATGCTTAATGGTGGTTCTATGCTGGCCTCAT
GCCAGACCCCGTTCCCTTTGAGCATTAGCTCCTGAGAGTGGGCTGCAGTTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved