Canis_familiaris Locus Mono:41:SNORA62
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:41:SNORA62
Canis_familiaris
Mono:41:SNORA62
4
SNORA62
1001..1153
2153
ATGACCCTTTGCCCAACTGCCGGACCTGGACCAATTTTGAAACCTAAAACCCATTTTGT
AAGGGAGTGTCATCGTTCCAAGGCAGAGAATGCTGCGACATCAGAGTAGGGATATATATA
TATATCATATATATATCATATATGTGTCATATATGTATATAGCCCCAGTCTTTCCCCAAA
GGGAAAAGAGTGAGGGTATATGGAAGACAAGAAATAAAGTCCTGATACTAGTCCACTCAG
CACAGTCTACTGAGACCATGGATACACCAGTGATCATATCTCTGATGGCCAGTGAATTGC
TGGGATGGACTTATTAGGGCATTGGCAGCATTCCTGTGCTGGTTTGGGGCCTATAGGGCA
AGAGTTTCTCATTAGAAAACACTAAGTTAAAGCTTCTGAAACTCTTCCCTACACTCTGAG
AACGATGGTAATAAATGACCCTGGCACATTCCACACTGTAATCAGATATTAGCATCACCC
AGCATCAGTTATCTATCTCCCCACTGAAGAAGTTTGCACAAACTATTACAACTGCCTGAA
AATCTCTTTTCTTCTATTTCATTTCACAAAGTACTACTAATGTTTCAGGCTTAGTCCAAT
CCTCACACCCTTCCAAAGCTATCTTACACTGTTTTAATTAGGCCAAGTCCCCCTTTCCAC
ACTGTCATAGTATCACATAGCTTTTCTCTGTGGGACTTGTCTTTCACCCACATGTTTATT
TGACTGATGTGCACTCTTATATACTAGAATTGTAACTTTACCTCAGAATCTATGATGGAT
TCAATAAATGTTATGACAACTGACTGGATTATATCTAGTCTTCCTATAATTCGAACACAG
GGAATTCTACATGTTGTGTAACTGGATATGTCTTGTAGAAAAAGATGCTTACTCTACGTC
ACAAACTTATAGATTTCATGGTACTTTCTTAGGAGAAAAAATATCTATTATAATATCCAT
CTTTGAAACAGGCAAAAGAAACAGACTTAAAACCATCCCAGGCTGCACATTGTTAAAGCC
TGGCATTGAGGCTGCCGACTGACCCAGGAACTCACAAGCGTAGGTGAAGTGCTCATGAGG
GACAAGTCTTGCACTAAAACCACAAGGGTCTCTAGCCCAATGAGTGGAGTTTGATAACAA
TTCTTGCTACAAGTAAAACAAAAAGCAAACAAACAACAAAAAGCATTCTGGGATCTTTGG
GTGGCTCAGCAGGTTTGGCACCTGCCTTCAGCTCAAGGCATGATCCTGGAGACCGGGGAT
CAAGTCCCACATCGGTCTCCCTGCATGGAGCCTGCTTCTCCTCTGCCTGTGTCTCTGCCT
CTCTCTCTCTGTGCCTCTCATGAATAAATAGATAAAATCTTTAAAAAAAAATAAAAAAAA
AACTCCTAGAAACTAAGAGTAACTTCTGGGAAAACTTAAGTAGAAGTAAAAAAATAAATA
TATAAAATCTTATTAAAAATAAACATATAGGAATGAATAAATGGAAAAAATAATATGCTT
AATATTCTAGTAGAAATTCATGTGTGTTTCTACACGAGTACAAAAAGAATAATATGTAAC
TTCTACTTTAGGAAGATGTGTTGGTCTAGGGAGGATTTTGAGGAGGAAGCAACATCCCTA
CTGATTTATACATATGAAATAGAGAACCAAGGAAATTGTTTATTTAGTGCAAGTCGCAGT
TTGAATTGTTTTCTATACATAATCTTATTTATTATACACAACAACTCTGTAAATTGAATC
TCGTACTCCTATTTTATAGAGACGGTGGGGAAGGAATTAATATTTATTACTGTGCAACAG
GTATCGTGCCAGCTTTACATATGCTCTTGCTTCATAGTCAGAACAATGCAGAAATAACGC
AGGTTTTATTATTATCGTTTTACATATGAAAGAGCTTTAAGTTAAAGAGAATATTTAATT
CGCTGAAGGTCACAGACCCAAAATAAAAGTCAAGACAGAATTTGAACCTAAGCTGGTTTA
TTCTTGCTCCATGATGTGGAGAGGGTCCCTCTAGGGTCAGAAAAAAATGTGAATTTAAGG
AGCTATAAACAAATTTAGCAGAACACTAGACCTTTATTGAATATATTATTTTACCTGCTG
TACACAAGATTCCATGTGTAGAGAAGCTGTTTTCTGAAGGGGTCTATGGCAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved