Canis_familiaris Locus Mono:60:SNORA42
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:60:SNORA42
Canis_familiaris
Mono:60:SNORA42
22
SNORA42
1001..1141
2141
CTGTTCAGTGTTTTGTTGGCACTTGTTATTTTTAAAATTTAAAAAAATATTTTACGTAT
TTATTTATTTGAAAGAGAGAGCAAGCAGGAGAGAGAGAATAAGCATGAAGAGGGGTGGAG
GGAAAGAGAGAGAAGCAGACTCCCCACCAAGTGGGGAGCCCACTTGGACTCGATCCTAGG
ACTCTGGGATCTTGACCTGAGCCAGAGGCAGATGCTTAACCAGCTGAGCCACCCAGGCAC
CTCAGTATGTACAATTTTAGATTAAACTATCTCCTCATTAGGTTGTGAGCTAAGTCTTCA
TTTCTTTTTAAGCATACTATATTTGCCTCAGCAGGTACTTAATAAATATTTGTGGAAGGC
TCTAAATGGATTACTTTCTGACCTTCAGTTTTGTGCCACACCTACATTCCAGTTGCTGTT
CTACTAACCATTCCCTGAACTCTCCTTTTATTAATTAATTAGTTCATTTCTTTCTTTATT
TTCAAAGAATGTGCATTTGCTTGAGCTTTTTTCTGGGATGCCAGAATCTCTGTTTTCTGC
CTATGGAAATTCTTTTCACCCTTTATAAACACCAGCTTAAATGCCATTCTTGCAAGAAAC
TTCCTTGGTCCCCAGCAGAATAAACTCCCACAGCCTGTTGACGGTAACCCCTAGTTTCTA
TTCAAAGCTTCTGCTCTCCTGCAGTTTTAGATTATGCTTCTCTGTATCTGTCTCACTTGA
TTATGAACATCTTGAGGGCAGGGAACATGCCTTGTGCATGTTTCTAGTCCTTAGTAATAT
TCCAGGTGTTAAATATATGTTCATTTACTTAAACACACTTGTTGAGTATATCTTTTTAAA
TAGGTGGAACTGGAGCTTGAGCCTACTGCCAATCATTTTTAATATAGGCCAGCCAATCTT
AGATGGGCTATTATGGAGCATATACACAAGCTTCAGAGCAGGGATTTGACCAAGATTTTT
ACTTTCAATTATCAGTCCCCACATAGATGCTTTGTTTCAGCCCATGGTGATGTACTGATG
GTGAGCTCTTCTCCGTGGGCCTTTCCTACTGTACCCTTGAGAGCTCGTTGTTCCTGCGTC
CCTCAACCATTGCCCAGGCTCCTCATTGGTGGGCTGTGAGCACTAAAGGGGGCTCTACAA
TGTAAAAAAAAACCAAACCCACTTTGTTTCAGTATCTATGAGAACTAAATTCTGCTGAAA
ATACCAAGAAATGGAAAGCCAACTGCCACCCCCCCTACAATGTAAGTCCTTTTGAGCGGC
TCTTATCCCTGTTCCCATATTGATCTATACTTTTTTTTCTGTCCCTGGACTCTCTTTTTG
TATTGCATGTATGTGTTTCCATGAGTTCACTGTAGGTAGACTTCTCTTATCCATTTGCAT
ACTCAGCAACTAACATACCACCTGCAATTACAGACATGCAATAAATATTTGTTGAATGAG
AATGAGAGGCAGAAAGAATTATCGTGGATAAAGAACTATTAGATATTATGTCCATCTTCA
AGGCATTTATGCCAGTTAGGGAAATAATTGCCTAAACATTCTGACCATAATGTCCTACAC
TTAATAGACATTCAATACATTTTAATGAATTACAATTAATGAAATGAGAGCCAATTTCTG
TGTCCAAGAAAAATGCTAAATACTTATCAGGAGGTATAAGTGGCTGTTTCTGTCCTCTAG
GAGAGGATAATCAAGTGTGAGGTAATAAAATGTTCATGAATACATTCCTCAGCATGTTGA
GTTTCCTGCCAAATGTGTCTTAGAGATATCACTAGAAGCTGGTATAGTTAGAAAAGGCTT
CCCAAAGGAAAAAGGTCTTTGTCAAGAACTGTGAAAAAGCTAAAATTTTACCCTATTTGC
AAGCTGAAAGTTAGTCTGTCGCATTTTCATAGGTACTTGAAGAGAACACAAAACTTCTAG
GTCAGAGATAATGGACCTCCTCACTCACAGGATAGCAGGCCATAGGAACTTTGTATCCAC
CCTGGTGAACTGGTCCTCCAAAGCCCATAGGGCCAACACAAAGTAGTCCAGGAGGGCACG
GTACACTCTGTGGGTTTGTATCACAGCTGAGGAACCCTGAGATAAGGAAACCCCAATCTT
CTAAAGGGGCTGTTAGCAAACCTCTTCAATCTACCCTGGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved