Canis_familiaris Locus Mono:113:SNORD22
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:113:SNORD22
Canis_familiaris
Mono:113:SNORD22
17
SNORD22
1001..1124
2124
TTTCCATGATCTTAAACTTTATTTCTGTTTTCCTTCTACCTATCATCCTATTTCTCTTG
ACTAGTACTGCCAAACCTACTGAGTGTGTATAATTCCATGGCCCCCAGTCTCTTTTATAC
TCAGACCCTTTTCCCTGGTCATCTGCCTTCCATTTCTTTACCAGAAATGCCCTCCAGGAG
ACCACAGCATCAGTTGATCAATTTTGAGAACGATTCTTAGTGTTCTCACCTTTCTTGATT
CCTCAGTAGCATTTGGCCTTGTGGATCACCTCCTATTTCTTAAAAGCCACTCTTTCACCC
CCTCAGGGGTAACTCTATACTTTTGTAGCTACTTCAGTGATTGATTCTTTATCTGGACAA
CCATTTCCCCATCAGTTACATGAGAGAGGTGGACTAGGGTCATTTCTAGGGTTTCTTCTT
ATACTATAAATTTCAGTTTCTTTTGCTGGAACTTCTTCCCCCACTTTTGACTGTGCCAGT
CCTTCATGACTTAGTTCTTTGCCCTCCGTTTGGTTCTCTTCTCTTACTTCCATGGAGAAA
TAATCCACACTCATCTCCATGTGGAGGAATTCATATTTCCATAGCTTTTCCAAACCTCTC
ACCCTCCCTGCCCTTATGTCCAGTTGTCTGCACATAGATGCTACATCATCCCTTCATACT
TAGCACTTCCTCAACCCCAAAGAACACTGGCTCCCAACTTCCCCAATTTTTACCCATGAT
ACCAGAGGCTTGGATGAGGTATGGCAGGGGGGAAAGCTAAAGGCCTCTAAGCTACATTCT
GAGAAAATAAGAAGTAAAAAATAGGCCCAGTATCTGGGGAAAAGGATTTAATAGAGGAAC
AACAAAAGAAACCATTTAACTCCAGATCCTTCTCTCCTCCCTAATAAGTCTTTCCTAGGA
ATGGAACCAATCTTCAAGCCAAAAGGGCCAAACATTGTTGGGATGGATGAAAGCGTAGGT
GACTACGTAGTGCCAGGTTGTTTTTAATGAGTTCAGATCCTTCCCAGTGAAGAAACAGTC
ACATGTCTTACCTCCTGTCCTAGTCCCAGAGCATGTAAAGGTGAACCACTGGGGCTGGCT
GGGGGAAAGGAGGAAGCTTGCTCTAGAAGGAACTGTCTGAGGGATCATAAGGGATTTCCA
AATATGGGAAAAGGGAATAAATCATTTGGTGAAGTAAAAAGAAATGAGTTCAGATCTTCA
TATACAGATGCATAATGCTGTGAGATAGCAAAAGAAGTTCTAGATGTTACTTCAGAGAAC
AGTCTAGGAAAAGTTAAGATACTTTTGGATTTTTAGTTTCAGAGAACCAAAATACAAAGG
CAAATGTGGTCCTAGTGTTTCAAAATCCATAAAATGAGAGACTCCAGAGTCTGAAGATCA
AGGGCTCTTTGTCCCCAGTAGCATCTAGAGTGGACTCTTAAATAAGTAAAAGTCTGTGAG
CACTTAGGAAAGAAAGCAGTAATCAGCATTAGGAATCATAGTTAGTGAAACTATCTCTTT
TCTGTTTGGTTAACAGACCAATAAATCAAATATTCCCAAGAAATTTGATAAAAACCTTTC
CAGGTAATGTTTTTTAGTCTTCATGTCGGCAACTTCCTTTTCCTCAGTCATGCCATACCT
GTGTTTGTAATGACTTGTTCAATGTCTGACTTTTTTAGCAGACTATGAACTTGATGAGGA
CAGGATACAATCATGCCTATTTTGCTGCTGTATCCATAGTTCCTAGTTTTGTACGTTCTG
ACTAAAAAAATAAAAGAATCAGTTACTTAATAAGTAGATGTAAAATGTGAGCTGGGTGGT
AATAGGCTTATAAGTGATTGCAAAAGTACATTTAAAAATTAATAAATTACTGAATTGATG
TCAGTCTAAGGTTAGCTCTAACTAAAACTCTTAGAAGAAAACCTTCATGACATTGGATTT
GGCAGTGATTTCTTGGATACAGCACCAAAAGCACAGGCAAGAAAAGAAAAAATAGACAAG
GTAAACTTCATTAAAATTTTAAAACGTTTATATATCAAAGGACACTACCAGTAGAGTAAA
AAGGCAGTCCACGGAATGAAAGAAAATTTTTATAAATCATATTTCTGATAAAGGATTGCT
TCTAGAATATATAAAGAGCTCCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved