Canis_familiaris Locus Poly:25:SNORD88
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:25:SNORD88
Canis_familiaris
Poly:25:SNORD88
1
SNORD88, SNORD88, SNORD88
1001..1092, 2687..2779, 3153..3243
4243
CCAGCCCCCGGGCAGCTGGCTCGTGTTCTGTCTCCCAACCACCACCCACCAAAAATTCT
GTCTAGCGGAGCCTGCTGTCCCTTCAGGCAGCCACCTGGAATACCGCGGGCTTCACCCTA
ACTATTGGCATGTCGCGAGGGAAGGATTTTTCTCCATCCCTGGCGCGCCTTCTCGCAGTT
GTCCGATGTATTCCTCTTTCGTGTTTTATCATTAAAATCCTCAAGCGTAGCCAGGAACTA
GCCAGCAGTTTCGCACTTGTAACATTTTGCCTTGTTTGCGCTTTTTTTTTTCCTTAAGAT
TATATTTATGTATTCATGAGACACGGGCAGAGGGGGAACCAGGCTCCCACTGGGGATCCC
AGGACGCCGGGGTCACGCCCTGAGCCTAAGGCAGACGCACAACCGCTCAGCTACCCAGGT
GTCCCATGTTTGCTTTCTTTGCGCTTTGTGTGTGTGTTTTGAAAGCACGTTTTGAATCTC
ACCCAATATCGTTAATACTTTATCTCCAAAATGATGCTGTCTCCTGTGTGCTTTGTGTTT
ATAGAGCCGGAGTCCTCTCCAAAATGTCTTCCTCTGCTGATTTGTTCCACAGTGGTTGCA
GTAAAGGGTCCCTGGTTGTTGTATGTGCTGCTTATATCCTAGGGGTTTTTTTTCCCCTAG
AATAGCTCCTTCCTTTTTATCTCCCAATAGGTTCTTCCAAGGGATGTGCATTTTAGCCAC
TTTCACTGTTTCGAGTGACTAGCAAGGGTAGCTGAATGGTGAAAATCTGTAAAGCTGGGC
AGGGGGTGATAGACACTGGGTTTTCTCCATGTAGTGGGTTTGGACAGTCCCCTATGGACC
TGTGACCCTGGGGAGGTGGTGTATCCTGTGTGTCTCCATGGGGAGAGTTGGGGGTTTTCA
TACCTTCCTAATAGATTTTGTGTTTCCCAGTCTTTGAGTGCAGTTAGTTTGGCCTCCATT
CCTGAAGATGATTGGCCTTGAGACTGGTTGTAGTGGGGACCGGGCCTCCCATGATGTTCA
GCACTGGGCTCCTATCACCCCTGAGGATGCAGTGCCTCCCAGGACCTTTGACACCTGGGG
ATCTGAGAGGCCCTGGTTTTGAGGTCTCTGGACCCCTCCCTGCCACAGACTGTTTCTTCC
TCCATCCTCACCAAGTACTTCCTGTGTTACAGGTGTATCTTCAAGCTGAGGGACCACCCA
CTACCACTCCCATCTTGGTGAGAACCCTTGCTTCCACTCCCTAGCCCCACCCCACCCCCA
CCCCCCAGTCTAAAAAACTTTGATTTGGGATGATTTCACATCAGATTTCTCTGGGACCTA
ATTTATGTGCCAACATTTGTGCTGGGGATTTACATGCAAATCCCAGTTCATTTATAGCAG
TGGAAATCTAGCCAGAATGGGCCTGGGTCCAAATCCCAGCTCTGCTGTTCATGGGCTTAG
AGAGCTAGTCAAGCGGTGGCTCTCCTGAGCCTCAGTTTCTATATCTGTAGAGCAGTTTCT
ATATCTATATATGTTAGGAGCGTATGGGCCTGAATCCTCCGCACGGTTGGGAGAGGGGCA
GTGATGTTTCCTGCTTTCAAAGGTAGGGTCGAATTGGAGAATACAAGGATTGTGGAAAGA
AAATAAACGTGTGTTTATGTTTCAAGAAAAAGGACTAATCCGAAATCTAGTTTTCAGAGT
CAGCAGAAGAAAAGAAACAAGCTGGCAGCATTTATCACTGTTGATAACAGGGTTTTGTAG
ATTGTATCTTGAAGCAGAGCTTGTCTCAAGAATCCTGTGTGCAAAAAAAAAAAAGAATCC
TGTGTGCATAAACTGATACAGTTGTTAAAGTAATCCTTCATTTACACAAAACCATTGTGT
AAACCATTCTCCATTTATCTGGAGAATGTTTCTCAAGTGTTTCAAAGAACTAAATCATAA
AATGGGTGTAAAGACCTATTATCTAAAAAGAAACAGGCTGTTCCTAGGGTGTCAGGAACA
GAAAGAACATTGGCTGTGGTGATAATAGGACTGGGAGTGTATTCTCTGGGGTCCTTGGAG
GTTTCAACTCTTGCTGACAGGCACTTTAAGGAGGAAAAGCTCCTTTCTGTGATGGGTGAG
CTCAGACTGCAGATCAGGAGTACCATTCTGAGGGCCTGAGGTGTCCCCTGTAGAGCTCTG
AACGGTCGCTGCTGCTGAGAAGGAAGATCCGGGACAGTGGGGTAGGAAGCTGCCATTTGT
ATGGCGGGGATGATGAGGGGAGGAAACAAGAACAGAACTGGAGGCTTTGGAAGATGCACA
AGGAGAATAGGCTTGAGGTGAGAGCAGAACAGATGTGGGAGTGTGTTCAGTAGGGTGCTT
CTTGGAGCTGAGCAGAGGAGGGAGGACCCCCTTCACCTCACTGGTGTGCCAGGCAAATTT
CTTCCCTTTTTCCAGGAGGAGAAACAGCCCCGGAGTTGGGGGCTGTGGGGTCAGGTGCTG
AAGGCAGTAGCTGCAGATCATACAAGTGGCACCCAGGAATGAGCCACAGTGAGGGGTGGT
CAAGAAGAGAGGAGGTGGTGGAGGGGTATGGCATCAAAAGGCATGTGACACCCCAATGGC
CAGGTATTGGTCATTTGTCCTACCTGGATGAGCTCTTGCTTTCGTTCCCCTTAGGACTGG
AGACAGGTGGCTTTGGGACCTGAGTGAGGAGGAGAACAAGAGCATCGGGGCCCCTGTGAT
GTCCAGCACTGGGCTCTGACCTCCCCTGAGGACACAGTGCCCCCCAGGGACCTTTGACAC
CCAGGGGTTCTGAGGGGCCCCACTCTGGGGAGGGAGGAGTGGAGGTCCATGGTTGCCACT
CCCCAATGACCTGCTCTTCCCCCTCTCTGACCCGTTCCTGTCTGCAGGTGGTTCCCCCAG
GAGTCCCAGGCCCCCACCGTTCCTGTCCTTGGTAAGAACAAGAGAGGCTTTGCTCTCAAT
ACCATAATAATAATAAATTTATCATAAAATCTGTAGGTCATGGTACTATAAAAGCAAATG
CTGAGCATTTACTCAGAGCTGGGCCTAGTGCCAAGCACTAAATTGACCTAACTTCTCACA
GTATCCCTAGGAAGCGGGGGTGGCAAGAAGAGTTGGTTACTGCAGAGGTCGCAGTAACGC
TCACTGTCACAGCTTCTGAAGGGGCTGTGCTTGGGACCCCCATGATGTCCAGCACTGGGC
TCTGACCTCCCCTGAGGACACAGTGCCCCCCAGGACCTTTGACACCTGGGGATCTGAGGG
GCCCCACTCTGGAGGGGGGGAGCTCTAGGGGGGGTGGCTGTTTTCCCACCTGATGACTTC
TGTCTTTCCCTGAAGCTCCTGTGGCCACACCCCTCCGGGCTTCCTACAGTTCCCTGCAGG
GGACAGCTGTGATCATGGCCGAGAGAGCCCTGGCGCCTACCCAGATAGGGCGGGGGGACC
GTTACTACACATACACCGAGCTCCTGGCCATCTCGCGGCGCTTCAAGCAGAACCCCAATG
AGCTCATGATCACCTGGATCCTGCGGGTGTATGACCAGGGAGGCCCAGCCCTGTCCCTGA
ATTCTGGAGAGCTAGCCCTGCTGGGTGACCTGACCAGCGATGCCATCTTCAACTACCGCT
GTAAGACCCTGCGGGGTGGCTGCAAGACGCTGCTCACCTGGCTGCTGCTGGCCTGGCGCC
AGCGCTGGGAATCCTTCCTACACTTCGAGGCCACCGAGCTGCCCTTCCGCCCCTGGACCA
CCATGGAGGAGGGCATCCAGCTGGTGAGGGAGCTGGGCATGCTTGACTGGATCTACCGTG
AGTCACCATCACCTCCTGCAGCAGATCAGGGGCCCAGGCCTGCGCCCGAGGATGTGCCCT
TCACACAGGGCCTCCAGCGGCGCCTGCTGACAGCCGCACCCTCTGAGCTGCGGCTCTCAC
TGGTCAGCCTGCTGGTCAAGGGCATGACGGTGCTGGAGGCAGTGATGGAGATCCAGACCA
TCGCCGATGTGGGCCTGCTCTGGCGCCAGAGCCAGCCAGGCCGAGCCAAGCTCATGTTGG
GGCCCAACCCGACACGCAAAGATCTCATGGGCTGGCTGCTGAGCCATGGCGTGCCCAAGG
AGAGGGTGGACAAGCAGCCCACCAAGGTCCTCCTGGAGCTGTACATTAAAGAGGCCAAGC
GCAGCCGCAGCCACCCTGCCTACATGCTGGGGGAGGAGCAGCCCCCACCACCCCCCTACT
CAGACCAGGCCTGTGGGGAGGAACCACCTGTGCCCGTGCGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved