Canis_familiaris Locus Mono:80:SNORD45
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:80:SNORD45
Canis_familiaris
Mono:80:SNORD45
3
SNORD45
1001..1079
2079
AAGCTCAAGTCAAGATCTCAGGGTCCTGAGATGGAGCCCTGCATCCAGCTCCACCCTGG
GTGTGAAGCTTGCTTAAGATTTTCTCACTCTCCCTCTCTTCTGCACCCCACCTCCAGCTC
ATATATGCAGTCTCTCTCTAAACAAACAAACAAACAAAAAAATTAAATGTAGAATTATCA
TATGATCCACTAATTCTAGGTTTCATAGTCCAAAGAACTCAAAACACACATTCCAACAAA
TCCTTGCATACAAATGTTCATAACATTACTATTCACAGGGATGGAAAAAACCCCAATCCA
TCTACTGATGAATGGATAAACAAAATGTGGTATATTGGTCGTACAACAGAATATAAAAAG
GAATGAAGTACTGATTCATGCTACCTTGTGGGTAAACCCCAAAAACATTGTGCTAAGTGA
AAGAAGGCAGATGCTTTTTTTTTTTTAAGAATTTATTTATTCATGAGAGACACATTAAGA
GAGGCAGAGACACAGGTAGAGGGACAAGCAGGCTCCTTGCGGGAGCCTGATGTGAGACTC
CTTCCCAGGACCCCGGGATAATGACCTGAGCCGAAGACAGTCGCTCAACTGCTGAACCAC
CCAGACGTCCTCCTTAACCTCAATTTTTAAAATGTGTTCATTTAAGGAAGTATTGAGGAT
GCGCATCAGCTCTTATTTACACGGATTATATCTATCAATTTTTGTTGTGTTAGGAATCAA
AACTGGGAAATGTAAAATATCTTTAGGTATTCATTTTAAAATAAGAACGAAAACAAAAAC
AAAACAAAGCAAAAAACAAAAACGAATATGTAGAAATAAATATGGAAAAATTTAAAATAA
CAGCAAAATGATTTTATGGAAAATAACTACATTTTCCACAACAGAGATTAGTGAAAAGAG
TAATATTGCTTTACATTTTTAAAAACCTCTTGAATGCCTGGCTTAATGGAAGACAGCAGG
ATTCTCTCTTCTGCTTTCAACCTATTAAAATACCCCACTGTGGTCGATGATGAGCTGGCA
TGTATTCTGAATCTGAAGTTGATGATTACTCCTTCAGCTCTAGAATTACTCTGAGACCTG
AGAAATACCCGAATCTTTACAGGAGCTTCAGGGCTTACGTTCCTTCGAGGCAGATAAAGT
GGCGACTTTTAAACAGAAAGTTGGTGTGTGGCAAGATGGGATCCGAGTGAAAAAAGTTCA
GATGTATATGGGGATGTGCACCGGGGCCAAACATTAAAAGAGGAAAAGTTAAAAAAATAA
AATAAATTAAAATACTCCACTGTCAGGCAACTTTATATTTTTTTTTCTTTTTAAGAATAT
TTTATTTACTTATTCATGAGAGATACACAGAGAGAGGCAGAAGGAGAAGCAGGCTCCAAG
CAGGGAGTCTGATCCTGGGATGGCGGGATTATGACCTGAGCCAAAGGCAGAAGCTCAACT
GCTGAGCCACTCAGGCGTCCCAGACATTATCCTAACTTCTGTTCTACTGCCGTGCCAGCC
TGGCAAACCTGAGTCTAGATCGACCCAAGGATACCTCTTTTCCAAGCCTTCCTTGGGTTA
GCTGCACTCTTTCCTTTGCAGACATCACATTTCTAATGATGACCCATCTCTCCTATACCT
CTCCTTTGTCAGGCAACTTTAGAAGAACCTCAGCGTGTGCTCCTGAGGCAATGAATAATA
AATGTGAAGAAGGTAAATTATGTCTTTGCCTTACTGTGAAAGTAGTTTTGACCTCACAGA
ACCCCTGGAAGGGTCCCCCAAGAACCCCAGGGGCCCCAATCATATTTTAAAACCTGCCGC
TGAATGCTGTATAGGAAGGGACAACTTCACAGGCATGGGACCAGCACAATCACACAGGGA
CCTTATGCTTGGACCAATCACACAGCCCTAAATTTGGGGTTTTATGTTCTACGATCCTCA
TCTTTAAATTCCTAAGAATTTTTTTTTAAGATTTTATTTATTTATTCATGAGAGACACAG
AGAGAGAGAGGCAGAGACACAGGCAGAGGGAGAACCAGGCTCCATGCAGGGAGCCCAACT
TGGGACTCAATCCCAGGTCTCTAGGATCACGCCCTGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved