Canis_familiaris Locus Mono:164:SNORA9
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:164:SNORA9
Canis_familiaris
Mono:164:SNORA9
21
SNORA9
1001..1131
2131
CTTCTGTCATGCTTCAGCAGAAAACACGCATCCTTGTCTTTGGTTACCTCTTATTTCCC
AATCTTAAGGTATTTCTGAAGCAAGTTTTACCCCGAAAGCCCAAAGCTTCCTAATACTCT
GTTTCTCTCTAGTTCTTCAGTCTCCAGATTGTTTACCAAAGTTCGAGGATTGCTGAGAGG
AAACACAAACCCTCTAGTGGGGTTCTGTGCCATAGTTATCTCTAAATAGGAGTCAACAAA
GCATTCCCTAAAACAAACAGAGCTGACTGGGTTCTTAACAAAAACAAATCTTGGAGTTTT
GTTTGGTCCAATGTGAGCAGAAGCTGTCTGTGATAAGTTCTATAACTATGTACTATTCCA
ATTATCAAAAAAATTATTTTGACAAGACCCCTTGCAGCAACCCCCAGGGTATTCCATATC
TTCTGAGCAAGTCACACACGCTCCTCTCTGTGCTTTCCTTTAATTTGCTTCTTCTGTCCC
AATTTGCCTTCTTCCCTGACTCTGTAATATGAGTCCTACCAGTGCCATTGGTCCCAGCTC
CATCTCGCCTTCCTTCACAAACGCTTCCTGAAGATGGAGGAATGACGGAGTATGATAACA
CCTCTGTGATTCCAAGGGAGTGAAAAAGATACAACTCATAACATTTCCAGGAGAAGAGAT
AGTAGAATAAGGTCATATGCCAAGATTATGATATGCCTTCAGGTCAAAGTGGTAAAGTAT
TATTTTGTTTTGTTTTGTTTTCAAATTATGAAGAAGATAAAAGGTATTTTAGAATCCCCA
TTTTTGCAGAAAAGAAAATTAAAACTCAAATAGTGGTTAAATCATTTGTCCAAAGTCATA
CTGTTACTAAGTTGGGTGCGATTCTAGAGTATTAGCTTCCTCTTGCTCCTATGACAAATT
ACAACACGCTGAGTGGAAGAAAGCAAGGCTACTGTCTTAAAATTCTATTGGTCAGATGTT
TCACTGATGGAATGGTCTCAGTGAATTAAAATGAAGGCTTCCTGCAAGCCCCCAGCATGG
TTGGGTCTGGGGTGACCCTGCACGTTCCTGCAGTGCTTGAAAGAACATTGTGAAATGGTT
TGACGCCTTGCTTTGCTCCATCCAGAGCAAGATGATAGAAATTTCAACAGTTGATTGCTT
TCTTCCACTTCTGATGTGCTGGGTATGGCCAAGATCTGTACTCCCTGATATTGTAACCAC
TTGCCACATATGGTTAGATTAAGTTAAATTAATTAAAAAAAATAAATCAAGTTTTCAGCA
ATTAACTATGTTAATTTCTGGAGGCTCTAGAAAAGCATACAATCCTCTTTTTCCAGCTGC
TAGAGCCCACTCATGTCCTTTTTTTAAAAATAAGATTTTATTTATTTATTCATGAGAGAC
ACGGAGAGAAAGACAGAGAGACAGAGAGAGAGAGAGAGGCAGAGAGACACAGGCAGAGGG
AGAAGCAGGTTCCATGCAGGGAGCCCGACGTGGGACTCGATCCTGGGTCTCTAGGATCAT
GTACTGAGCCAAAGGCAGATGCTTAATCACTGAGCCACCCAGGTGTCCCCCACTCATGCT
CTCAGCCATAGTTCCCATCCTGTCTTCAAACTCAGTAAATCTATATGTCTCTGTGTCTTC
CACAGCCACAACTCCTTCCTTTTGTTCTTTTTGCCCACTTCGAAGGTCTCCTGTTTTACT
TTGGGCCCATATAAATGATCTAGATTAATCGCCCTACTTTAATATCAACTGATTGGCAGC
TTTATTTCTGTCTGCCACCTTAGTTCTCATTTGCTGTGTGACCTACAAATCCACAATATA
TTTATAAATAGAAAATACATTTATAAATAACTCATATGTGTAAGAGGAAATAATAATGCA
CCTTTAAAAAATTCTAAATTGGATTTCTAATAAAAATGCTGTATTTTAAATGTTTGGAAT
GTAGCCAAAGTAACCCTTTGTAGGAAAACTACATAATTCTGAAACACTTATATTATAATA
AAGGATAAAACCCTTAAAAAGTCTGCAAATTACCCAAATAAAGAAAGAAAATGCTGATAA
TAAAGAGAGAAGAAACAATTGTAAAAGTAGAAAACAAAATCAAATAGGAAGCTTAAGCAG
AAAATGATAATTCTTTAAGAAATATTAATATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved