Canis_familiaris Locus Mono:158:SNORA18
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:158:SNORA18
Canis_familiaris
Mono:158:SNORA18
18
SNORA18
1001..1126
2126
CATTTGGTAGAGCATGTGACTCTTGATCTCAGAGCTGAGTTCAAGCCCCATGTTTGGTG
TGGAGTCTACATAAAATAAAAATTTAAAAAGAAAAAAAGAACTTAGCTTGAAAAAAAAAA
GATCATCTATTCTCTGCACTGCTTGGGAAAGAAATACTGTGAATTCCACAATGAACACTA
GTGACATATATAGATCACTTTTCTTTTCAGATTCAGAATTTATTCATCTCAAGCAGTTTA
TCATTGATAATAGCTGCTGATTTTCCTCTTGCAATGGTCGCACTTTAGTAAATCTCAGTT
GGCAGCGTTTTATTTGAAGTCCTCTTCAATTTCAAGACAAGGCATATATGAAAAGGGGAG
TATGTTGGATCTAATTTAGGTACCTCCCCAGAAACACTATCCAACATGTCTTCTGGACAT
GCTTCCAATATGGAATTCCCAAGGCTGCTGTCACCGTGTCTTTTGCCAACAGAGATTATG
ATCTAATTCCAGTTCAGAATTTTTTAATAAAGATAGTGGAACTGCAAAGGTGATAGAATA
TGCAACTTCACCAGGATTTTCTTTCTGAAGTCAGAATTTTGATACAGATTAGGACTCTGA
TCTGTAAAGGAGACACATTTGTGTGGGGAAGAGGGAGAACTCTGAACTCACAGATGATCT
TACATCTTCTTGGTTGTCGTAAGTAGGTCCCTCTCCCTTGAAAGAGGACAATAACAGTCT
TCCCTTGCTTAGACACCTTGTGATTACCTCCTTTGAACAAGTCAGACAATGATATTTGGT
TTTCTCATGAGCTTCCTCCTATACCCTTCTTTGCTTCCAAACATGTAACTAGGTACAAGT
CACAAGGAAGGCCAAGCAGGAAAGTCCAGTCTTGCTCTAGGAGGATATGTCATACATAAG
AGAATCAGGAATCTATGGCCACTATGTACAAGTGTGACCTAGGGGAACACTTCCTATTGG
GGGGGGTGTGTTATTACAGTGTAGTAGAATAGAAGTTTAGAGTTGAGGTCTATCCCAATT
GGCTTTTTCTGCAGACCTACATTACTGGAGATGCATCATCAAATAACTATGTTGTTCACT
TTACTCACAGAACTATTAGATCTTTTGAATAGAACTATAAGACAGAGCTACCAAAAGTAT
GAAAGACCTAATAGTGCTTTTTATTTTAATCTTAGGTATTAGCATGTCCTCAAATTCTGT
TTTATTCTTGGATGTGCTAGTTTAGGAGTGAATATGATTTAAACTCAATTCATGCTCAGA
GAGTCCTAAAGTAAATTACTTAAAGAAATTAGATCCCAAAGTTTCTAGGTAGAAAAATAT
GCTCTCAGGAAGTCATCAGTGTGTCCATATTCAAACGGAGATAAAATAAGCCCAACTAAC
AGAATCACAGCTTGACATGGCAACTGAGGATTGAATATAGGGTATATATGCATGCATGCA
TATATTATTTTTAATTTTTGCTTTTTAGCATTCTTAGAATCTTCTTTATTAAATTTTTAA
ATTTTTTAAAAGATTTCTATTTATTTGATAGAGAGCACACAAGCAGGGGGAGTGGTAGAG
GGAGAAGCATACTCTCCACTGAGCAGGGAGCCTGACATGGGGCTCAATCCCAGCACCCTG
GGATCATGATCTGAGCTGAAGACAGACGTTTAACCAACTGAACCACCCAGGGGCCCCAGA
AACATCTTTATTACAAATGCTTTTAAACACTTCTCCACCTGTATTGAAGAATGGAATAAC
TTCCATTTACTGATGCTACAGAGTTCTCAATGCAACTTGCAAGTTCTTATTTTTTTGATG
ACACTCATATTGCAATATATTAATGTATCAAAACAACATCTTGTACACCATAAATTTACG
TAAGATATTTCCATTTTTTAAAAAGCAGACATTCTTTTTAAAAGGGCTATGTTGAAGAGA
AATTTTGATTTAAAATTTGGAGGAACTAAGGCAACCTTGGTGGGGAGTGAAAAACAATCA
CATTGAGATTTCCTTAATAAAAATTTACTGACTTTAAATAATGTTGCCTACTGTTGTACA
TAATTTTTTTAAAAAACTTTTTACATTTAAAAAATGCATATGTCTGAAGATAGATTTTTT
TCTTTTTGACGTGAGGCACTTACCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved