Canis_familiaris Locus Mono:26:SNORA57
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:26:SNORA57
Canis_familiaris
Mono:26:SNORA57
11
SNORA57
1001..1141
2141
CCATTTTTAATTAAAAAAAATATTTGTATCCCTACACTCATTTATCCCACCCCCTACCA
CCTGCCTCTGGCAACCAGCAATCTATCTTCTGCATCTGTGAGCTTAGTGGTGTTTCGTGT
TGTTTTGATATGTTTTTTTGTTTGTTTTAGATTGAACATATAAGATAGATCATAAGGTAT
TTGTCTAGCATAATGTCCTTGAGGTCCATCTGTGTTGTCACAAATGGCAATATTTCTTAT
TTTTTATGGATGAGTAATATCCCACTGTACATATACCATAATTTTTTAAATTTATTTATC
CATCAATGGACACTTAGGTTGTTTCTGTATCCTATTATAAATAGTGCTGCTATGAATATG
GGGATACATATATCTTTCATAGTTAATATTTTTGTTTTCTTCAAATAAATACCCAGGAGT
GGAATTGCTGGGTCATATGATATTTCTAAATTTAATTTTTTTAGAAACCTCCATACTATT
TTCCATAGCAGTTGTACCAAATTAAATTTCTACCAACAGTTCACAGTAGTTCCCTTCTTT
TTACATCCTTGCCAACACTTGTTATTTCTTATCTTTTTTATAATATTCTTTCTAACAGGT
GTGAAGTGATATGTTGTGGTTTTTATTTGCATTTCCCTAATAGCTAATTACATTTCATTT
CATGTACCTATTGGCTATGTGTATGTTTTCTTTGAAAAAATGTCTATTTGTATCTTCTGA
CATTTCTTGATTGCTTTTTTTTTTTTTTTTTTTTTTGCTGTTGAGTTGTATGAGTTCTTT
GTATATTTTGGAATTTAAACCCTTATCATATATATGATTTGAAATATTTTCTTCCATGTA
ATAAGTGGTTTTTAAATTTTGTTGATAGTTTCTTTGATGTGCAAAAGCTCTTTAGTGTGC
TGTAGTCCCACTTGTTTATTTGTGCTTTTGTTGCTTTTAATTTTAATGTCAGATTCAAAA
AAATCATCACCAAGACTCATATCAAGTTGCTTACAACTAACCCTCCTTTTCTTGGCGGGG
GTTGGGTGCGCAATTCCTGTAATGTATGGGGAGGCAGAAAGGGCTCTGGCCCCCTCGGTG
TCATGTCTTTAGAGCCCACGGCTTCCAGCCCGCTGGTTCTATCCTCAAGCCCTGGGACAC
GGAAAAAAAAAAAAAAAAAGTTGTTTGTAACTATGTTTTCTTATAAAGATTTTATGGTTT
TAGGTCCTATGTTCAACTCTATAATCCATTTTGAGTTAATTTTTGTGTATGATCCAGGAG
GTGGTCCAGTTTTATTCTTTTGCAAGTAGTTGTCCAGTTTTTCCAACACCATTTATTGAA
GAGGCTGTCCTTTTCCCAACATATATTCTTGACTCCTTTGTCATAAATTTGACCATATAT
GCCATGGTTTTTTTTTCTGGGCTCTGTGTTCTGTTCCATTGACCTATATAACTGCTTTTA
TACCAATACCATACTGTTTTAATTACTATAGCTTGTAGTTTAATTTGAAACTAAAACAAA
CCTCCAGCTTTGTTCTTTTTGTCAAGATTGCTTTGGCTATTCAGAGTCTTTGTGGTTCTA
TACAAATTTTAGGATTGCTAATACTATTTCTGTGAAAAGTGCTTTTGGAATTTTGATAGG
GGTTGCAGTCAATCTGTAAATTGCTTTTGATAGTAAGGATGTCTTAACAATATTAATTCT
TCTAATCAATGAGCACAGGATATCTTTTATTTATATCTTAAATCTCTTTACTAAATATCT
TGTAGTTCTCTGCATATAGGTCTTTTTTCTCCTGATTAAATTTATTCCTAGATATTTCAT
TATTTTCACGCAATTTTAAAGAGGATTGTTTTCTTTATTTCCCTCTCTAGTAGTTCATTA
ACAGATTTTTGTGTATTGATTTCGTAATCTGCAACTTTACCTAATTTTTCTGTTCTACCA
GTTTTCTGATGAACTCTTAGGATTGTCTATGTATAATATCATCACATCTACATATAATTA
CAGTTTTTATTTCTTTCTTTCCAATATGAATGCCTTTATTTCCTTTTCTTGCCTAATTAC
TCTGGCTAGGACTTGAGAAGAATGTGTAGTTCTGTTTACTTTTAGATGGAATGTTATATA
GATATAGAAATAGGTATAGATATACACTAATTTTGTATCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved