Canis_familiaris Locus Mono:28:SNORA52
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:28:SNORA52
Canis_familiaris
Mono:28:SNORA52
5
SNORA52
1001..1135
2135
TCTCTATTAGACAAGTCTGTAAATGTAGATACAATGTCAATTTCTTTTCACCTTTGTGC
CCTAGCACTTACCACAAAGTCCAGAGCTTTATATGGTGTTCAATAAATATTTGTTGAATG
AATGTAACTATGCAAGAAGTTAGTGTGAGACTAAAATCTAGGTTTTCTGACTCCAACTTT
CACATTAATTACAATCTGCTGCTCTCAATTTGGTGTACTCAAGTCTGAGAACCAATGCAA
TGCATTTATTAAGTGCAAAGAAAATCACTGATATTTTTCAAATATTGTTTTTGGCAACAC
TAATGGTATATAATATCTAGGCATGATTACTGTATTAAAATGACAGAGTTCTTGTGCAGG
CTTGATTACTTTGAGACCTTGCCACTTATTTCCTGAAATACATCTGTGATGGTTAATTTT
ATGTGTCAATTTGACTGGTTTAAGGGATACCCAAGTAATTGGTTAAAAAAATGTATTTTC
AGGGGGTTATGCCTGTGAAGGTATTTCTGGCAGAGGTTTAACATTTCATTTAGTGTATTG
AATGAGATCTGCCTTCACTAGTATGGGTGGGTATCAACCTACTGGGAGTCCAATTGGAAC
AAAAAGGTGAAGGTAGGGCTAATTCTCCTTCTTTTTGAGTTGGAATATCCATATTCAGGC
TCCAGGACTTATGCCAGAGGCCCCATTGTTCAGGCCTCTGACCTTGGACTGGGAGTTATA
CCACTGGACTGTGAATCTCGGGCCTTCAACTCAGACTAAATTATACTGCTAGCTTTTCTG
GTTCTCCAGCTGGCAGACAACAAACAGGTCATGGGACTTCCTGGCCTCCATAACCGCATA
AGCCAATTCCTAGAATAAATCTTCTCATATATTTATCTATTGGTTCTGTTTTCTCTTCAG
AGCCCTAACTGGGTACAATAGCCATTACTTGAAACAATTCAAAAGCAACTTTCACTATAA
ATTGCTTTTACACAATAGGAGGGTTAATAAATTAGGAACTATGGTCCATCCTAATCCCTG
CCAGTCGGCCTGTGGCCTGCCAGGTTTCATTTGTGGCCCAGAATATTCTAGAAGCCTTAC
CTAGAGGAGTGAGCAAGGCTTCAGTGGGCTTGTACCAGAGGTGCTTCTAGACACTCTGGG
AAAAGAAAAGAAAAAAATAAATAAAACTAAGTAACTGAATGTATGAATGCCTTTTTATTC
AAGAAGAATATATATGTAATGATTACAGAAAAGATGGAGAGGCTGTCTGAATCAGAATTG
GCTGTTTGGGGGAAATACCTAGCTATTCCTCGTAACTATGTGTGAAGAAAGGGGGCAAAC
TGTATAGGCCCTTTGTAAACTCACTGGGGTCCTTGATTTAATCCAGTTATGAATCTTGCA
GTACTTTCAGATGGGGACTAATTTTCAGATCACCGTGCCTCTCTGTTCCCTTCCTCAAAA
CTCCTCTGGGCATTGCGATCTGATTTGAAAAGAGGGTAGCCAGGGTGGCCCTGAAGCATT
GAGGTGGTGACTGGTGACTGTCCAATGCTCTGACCTACTCTCAGCTACATGTTAGACATG
GTGGCTTCCAGGACACATTGCAGGATGTTATGGTAAGTTCCTCAGAGGAAAAATAAATAA
AGAATGGCTTTCCCAACTACTGAAAGACCTTTGGTTGAAAGGTATGGTATAAAGTACTTC
GGAATCTGAAAGGTTTTTCTTTTTCCGGTGGAAATGACTTTGAAGGATGGCTCAATGCTG
AGGCTAACTTGTAGAAGCTTATTAAAACATATTTAACGGAGTGCTTGGGTGGCTCAGTCA
GTTAAGGATCTGCTTTCAGCTCAGGTCGTGATCCAAGGGTTCTGGGATGGAGGCCCATGG
GCTCCCCGCTCAGTGAGGAGTCTGCTTCTCCCTCTTCCTCTGCCCATCCCCCTTTGTTTG
TTCTCTTTCTCTCTCAAATAAATAACTTAAAATCTTTAAAGTAAAAACCATAATGGTATG
CTGCAACCAACTGAGGTGTATAATCATGTTTCCACTAGAATATATACAGGAGTTTTCAAC
TTGAGATGACAAATGCGTGTACCTTTTTTGACTGATTGAAATTCATCCATTCATTTATTT
AACTGTCACTTAATCACTGACCCAACACTTATTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved