Canis_familiaris Locus Mono:11:SNORA35
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:11:SNORA35
Canis_familiaris
Mono:11:SNORA35
X
SNORA35
1001..1129
2129
GCCAAACTATTCTTAGAATTCCAGAATGGCTGAGCACCCAAATGGGCATTGTTTGGTAA
GGCAGCATACCAAAACTGGGACAAAACTAGAAGAGCTATAGAGAAAGGCTTGTTTTGATA
GGAACACTATACATTTACAAAAGTGCATGGTTCATAGTCTTTGATCAATGACTTTATGAA
GCAAACCAAGAAGAAAGAAGCAATGATTATTTGACAGTGGCTGCTCGATGTGCAGATTTT
TAGTCATAACCAAGGAAAAAATAGGACACACATCAAATGGAAAGTTTTCTGTTTTGTACA
TTTGGGAAAATGTGAGTTTCTTCTAGACACACAGGAAAGATGTATCTTCATCACATAATT
CAAGAATAATGATCTACAAATTCGTGTCAGGAAAGTTTAAGCAATTTTAAATAGTCATAT
TCAATATGTAAGCCCAACATAATTAGGTACAAAGCAAGTTGGCTTCTGTAAGGGGAAATT
ATAAGACAAGTAGAAAAAAAAAGTAGAATTATTAACTTAAAAAATTCCACAAATTTATAA
CCAAGTTCCCCACAAATGGTAATTTGAAAGAGAAAGGGAATTGTCATTGACGAGGTAGGA
GATGTTTGGTTTTAACAATGACTTACTTATTAAACATCTACTACTGTCAGGGCCTAGACT
GGACTCCGCAAGTTATCTCTTCTAATTCTTACAACAGTCAGCTGTCAATAAACAAGTTAT
TATTGAGCCTATTTAACATATAAGGAAACACAGGTCAAGAGGGTTTAAGTGAATTTCTAA
GGTTCCATAGCTCATGAGTGACAGAGTTGGGATTCTGAACCCACATCTGTCTGATTCTAA
ACTCACATTTCCTTCCCCTAAAGCTAACCCATGTATGTAGTAGCCATACTGAGTGAAAGA
ACGGATCCCTAGCTAGATGTTTTAGGTCTCGTATCCATCCCCTCTTCCAAGCTGGTTCTT
CTGCACAGAGCATGGGCTCCCAGCCCTAGCTCTATTATTTACAGCACTGGCAAGTGACCC
ATTGGGCTTCTCCTTGACCAACTGGGCATCGAGCAGTGCAAAAGCAAATCCCTCCACAAA
GCTGGGAGAGTCATTCTGTGGGCTACTCCTGCATGCTGGGGGGTACATATTTACTGGGTC
CTGTGGCCCTAAGAAAAGTGAGGGGGTGGAGAGACAAATCAAGCAGCTCAGTACCTGCTA
CTACTAAAGCTGACTATGTCCATATTAAGTTAATAGTAGGAACTCAAAAATGTTATTGTT
ATTACATTATCATCACCATTATTATTAGCTGAATAACTCCTAGCAATTTACATTTAACCC
CTCTTGGACTCAGTTTCCTTGTTCATAAAATAAGGTTGACACTACTGGAATGATCTAAGA
TTGCCATGGTGATTATATTACAAGATAAATTCATTTTAATACCCTGGAAAATTGCTCTTT
AAGTGTTAGTAGGACAGGAGAGATAAGTCATTTTTTTCCCTCTGATGTGATTAAAGTGAG
ATTATAATTATCTTGAAGATATTGGCTCCAGTGTATTTTATTTCTCCACATTTCTACTAG
CTTTCTGACAAACTAGCCTTCCCAGCCTCTTCATGCCCTGTGTGTAACAGTTTGTTTAAA
TTAGTGCTGATAGAATTCCTTTTCCATTATTTCTAATAACTTAGATCTATTTTCAAGATC
TATTCCTAGTCCCTTCTTTCCTTCATAATACCTTTGAATACTTAGGTCCCCACAAATCTC
TCCCTCTACCACAGTTTGGCAGTGACCAGTTTCCATTTTTTTGTGTTCATTAATGTTATC
TTATTAGGTAAATTGTAAATTCTTTGAAAGCAAATTCTTTGCTCACCTAGCCCAGTGCCT
TACAAAAAGTAGAAGTTTAATAAACAATTACTGATGGATAAATTCATGTAAGTTATTTCT
GAAATCAGTCATTAATTCTTATAACCAGAACTCAAAGAAAGTTCTAAAAAATTGAACACC
ATGGTTCAAGAACCATATAAAATGTGGCACTGTTTTATGTGGTAAATAAAATATAGACTG
AAAACTCACTTAAAATCCAGAAAAGAGGAGCGCCTTAGCTGGCTTAGTCAGTAGAACGTG
CAACTCTTCATCTTGGGGTCGTGGGTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved