Canis_familiaris Locus Mono:42:SNORD88
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:42:SNORD88
Canis_familiaris
Mono:42:SNORD88
28
SNORD88
1001..1085
2085
CTCTTCTTTCTTTTCGCTGTATTTCTTGTAGTGCCACTGCTTGAGAGGTCGCCAAAAGG
CAATGCTATAAAGTAGAATACAGATATATAATTGAGGAGGCTTTATTTTGCTTTTATCTG
AACCTACTAAATTGCTTAAAGCTGTACTCCAAAGAAGGAAGAATAAAAGTAGCTTTTTAT
ACTTGTTCCCCAGAATTTCAAGTGTCCCAAATCCTTCTCTTTTTTTAGAAGAAAAACTTC
CAATTGAAATGTTTTTATATAAAGGTGTGTGAAAGACATCAATACCAATACTGTATTTTG
ATATTCTGACCAAAAAACAATGCTTCTCCAAGCAAAAGAAATCCTCTCTGTAATTTGTAC
TCAAGACTGTTACTTGTCAAAATGTGACAACATGTCTTTGTCTTCATTATAATAGCAGGC
AAGTAAGAAAGGTTTACTGTGGTCAATTTTTTTTTTTAATTTAAGATTTTACTTATTTAT
TCATGAGAGAGACAGAGGGAGCAGAGTCACAGGCAGAGGGAGAAGCAGGCTCCCTGCAGA
GAGACTCAATCCCAGGGTCCTGGGATCACGTCTGCCAACGGCAGACACTCAACCACTGAG
CCATCCAGGTGCCCCTACCCTAGTCAATTTGTTTATTTCCCTATATTAAAAAGAATTGTA
GCAGATATGGAATATAAAGAGCAGAGAGACGGGGCAGCCCGGGTGGCTCAGCGGTTTAGC
GCCGCCTTCAGCCCAGGGCGTGATCCTGGAGCCCCGGAATTGAGTCCCGCATCGGGCTCC
CTGCATGGAGCCTGCTTCTCCCCCTGCCTGTGTCTCTGCCTCTCTCTCTTTCTATCTCTC
ATGAATAAATAAATAAAATCTTAAAAAAAATAAAACTAAAAAATAAAGAGCAGAGAGAAG
AAAATAAAAGAAACAGCTATTCTTCAAATATGATCATTCTTAATTCCTTTGTATTTGTTT
AGTGCTTTTTCTATGCATAATTTGTTTTTATAAAAATATTACTTTCCCCATGATGTTTCG
CTGGGCTCTGACCTCCCCTGAGGACACGGTGCCCCTGGGACCTCTGACACCCAGGAGTCG
GAGAGGTCCCGTTCTGGGGAGATGCTGGGGTGTGTGGCTATTTTCTTACCTGATCGCCTC
TGTGTTTTAAAAAAAAATAGAGACCCGAGTGGCTATTCACACTTGATAGAGGGCTGGTTA
TAGTTAATGCTGACATAAGATTGAATTACTGGTTCTCAGTCATATTCTAAAGGAATGGAA
ACCAGGAGAAGCAACTGGTTCGGTGGAAAGTCCAAGATCATAGTCGTCCGTCCTTTATTA
CGGTCAGAGACTGTTTGCCAACGATGACAGACCTCCAGCCGTCAGTCCTGACTTTACAAG
CTCCTGGCGGGAGTCAGTTTGCCAGCACCGAGCCGTGCGTGCCGGCTCCCTCGGTTAACC
GGTCGAGGGCGGCAAGAACCCTCTATGTGCGGAGTCAAGGCGTAGGAGACCAAGCGAAAT
CCCAAGACGCTGGCAGTGGAGGTGGGCGAAGCGCACGATTCGGCCTTGCATCCACCGCAA
AGACCACGATGGCGGCGGCTGGGCCTACTCCATGGGCAACAAGGCTGAGCTGAAGGCGGG
CGGACGCCTCGCAGACGTGGCCGGCCAGGATGCGCCAGGCGTTGGGGCGTTTCTACACGG
ATGCATTACGGAAGAAATTCATAGCAGAGCCAAACTGAGGGGATCGGGATTAGGCAAACT
CCCACACGAGCTGCTACTACTTTTGACCAACCACTTGCCCTGTCCTGGTCTTAATTTCCC
CATAATGGAAACGGCATCATTTCTTCCCCCTGGGCCTGTTGTGAAAAGAGGATTTAAACG
GCGCGGCAGTGCTGCTATTGGGCACAACTCAGGACACGTAAGCCGCGCTACAGGAGGAGG
ATGATAAGTAAGACCCCAAACCCCCCGCCGCCCCACCGCCAGCCTCTCTACCCAACCCGC
TTCCGGAGCCCCTTCACCTCAGCCGAACGCGAATCCCTCCGCGCTCGCGTCACTTCCGGG
AGGCTCTGGTCACGAGGCCTCGAAGTACCCGGATGCAACTATCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved