Canis_familiaris Locus Mono:142:SNORD21
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:142:SNORD21
Canis_familiaris
Mono:142:SNORD21
32
SNORD21
1001..1091
2091
GTTGATGGTGCTTCTCTTAGGCAGTTGTGCCAGGAAAATCCTCTTAGTTTTATCTAATG
GGTTTTAGGTAAGTAGTGCATTGAATGCAGTGTAAGAAACTTTTAGCATCTGTGGTTAAG
ATGTACAATAATCTTTTATATTAGTGGCTTTTATTTTAAAAATTGAACATTTAGCCTGTT
TCAAAGATGAGAAAAGAGAGGCTTAGTAGGCAGCATACAGCACATGGCAAAGCCTGGAAT
GAATTCTTGTCTGCTTCACTTACCTGCTGTATGACACCACCTGTTGGTTAGTTATGGGTG
TATGGTGAGCATGGGGGAAGTGTTTGCTTGGAGGAAACCTAAGATGTTCAAGGGTAGTTT
TATGAAGTAGTCCATTACAGTGAAGGATAAGTAGAAAGGATCTGTCTTCATAATGTCAAA
TTTTAATTTTTAGAAAAATTTAAAATACAGAAAAGTACAAAGACTAAAATGACAGACATC
TTTGTATCTATGAACCAAAGTAAACAGTATTTGCTTTAGATTTTGTAATGTAAGAAAACG
GTGACCAAAATTCCTATGCATCCCCTTCCTTCCTTCCCTCCCTCTCTTCCACTCTTTCTC
ACACAGATAAAATCCTGATGAATTTGATGCCTGTTCTTTCATGTTTTTATACTTTTATAA
TGTGTATTGAGACCAATTAATTGCTTTTATTTTTAAAAATTACCCCACAGTTTTTACATA
CACCAAATACACAATTTCACATTCAAAATAAAATCTTATAGCCACAAACCATGTAATAAT
TGCTAGTATTTACCAAGCAGCCTTGGTTCTAAGACCATTACATGTATTAACTCATTTAAT
TTTTCTAACAGTCCTATGAGTTGTATACTCTTATTTTTTCCCATTTTACAGTTGAAGGGA
TCGAGGCAAAGAGAGATTAAATAACTTACCCAAGGGTCACAAAATGTAAGTAGCAGAGCC
ACTGACTCCTATAGATAGTGTTGTTATAAATATTTGAAAACACTGAATGACATCCCACCA
ATTGAGCAGTCAGTAGTTGGTTTGGTTGCATATGATGCGGTTAAATTGATCCAAGATGGG
ACTGATACCAGGGAAAGAAAAATGTTAAAAAACTATTTTTTATGCAACTTATGTAAATGC
TGTCATATTGTACTTAACATTCAAAAACTTGGGTTTCACTCAAACGTTGTTTTTGAGAAT
CTGTTCATTTTGATAAATCGGGCCTAGTTAATTCCATTCAAGTGCTGTGCTTTATGCTTT
TGGTCATATGACCATACCATCTTTTTTTGGTCCTTCTCCTATTAATAGATATTTAGTTTT
GTGTCTTCCAATTCTCTATATTACAAGAAAATGCTGCAGTGAACATCTGTGTACTTATCT
TGTGCACTCATGTGAGAGTCTCCCTGGGCCACACGTTCACCCCCCACCAACCCTGTACTG
GAGTAGCTCAGTCAAAGGGTATTTACATTTTCAACTTTTCTAGATATCGGCAACTTACTC
TCCCAGATGTTTACGTCTCAGTTCATAGTTGACATTCCCACCAGTGAGAGGCTGAATGCA
TGTGAACAATGGCCAGACAGTGTATAAAAATAGAACTCTGCCCTGCAGCCTGCAGAAACC
TGCCCAAGAAGCCAACCCCTCATCTACAAGAAGCAGCCCAGGAGGCCAGCTTGCTGTGAG
TCAGACTTGCAGGAAGTTACTGTCTTAATTTGCATTTAACTGATTATTAGTGAGATGGAA
CCCATTGTATGAGGCAGTCCCTTCCAGAAAGGAATTATGAAGGATAAGTATTCTACCTTT
TACCTTTTAGAATAGGCGAGGATACCAATAGGAGATTATTTAACTTTACTCATTTCTGAA
GACAAGGGAAGAGGCCTACGATTGTTATATTAGACTTTTTCTTTTAAGCAGAAAAAGGTT
GTATTTTTTTTCTAAACTGAAGTCTAAGTAGAGTTAGCAAGATGAGAACTGGAGCTCCTC
AGGTAAAATAGTCAGTGGTATGGTTCTCCCTTTCTGGCCTCCTCTGCATCCAACCTGTTC
TCTTCTGCCCCCAAGTCACCCAACTCAGTGGAACCCTTGGGCTGGGTGGCGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved