Canis_familiaris Locus Mono:156:SNORD113
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:156:SNORD113
Canis_familiaris
Mono:156:SNORD113
18
SNORD113
1001..1062
2062
ATCTGTAAAAAACTTTCTAGTAAAAGCTTTTTACTTTTTTAATACCCTCTTATTTACTT
CCAAAATCAAGTGCTCTCAAATTAAACTATGCTACAGAGAAGTTTCATAAATAGGTAATC
CAGGCTCCCATTACTACTCATCAACAAAGAGTTCTGAATAACTAGCAACTCTCAAAATTA
CCCACAATTCTGAAACAATTCTGCCTGAAAGTAATTTCATAAAACTAACAACACTGCAGA
GTAACTTTTGCTTAAAGAAAGACATAGATGTTTGATTTATAAATATTTTCTTCTTAGTCT
AATAAAAATTCCAATGGGAAGTTACTATTATATCTATTTTAAAGATGAGAAAATTGAGGC
TTGGAAAGGTTAATAAACTTGCCCAGAATATCTACCAATGCCCTTAAGCAGCCCCAACCT
GGTGATACATCTACCGTCTTCAACCTGGATATGTTTACCTCTTAGGGATGCTTTCCAGGG
GGGATGGGGTACACCTGAAATTGTTTTAAAAGAATTCACATATCTCTATGTCCTCTTTCC
TAAAACTGACCTTTGAGAATGGCCTGCACAACAAGTTCTATCAACACCTCCTCTTTCACA
ATTACTCTCATCTCATGTTATAAAGTAAAGGCATATGCAACAATATGGTCGAATCTTAGC
AATATAATATTAATTAAAAGAAGTCATTCCCAAAAGATTACAAACAGCAATGATACCCTT
TTATAAAATTAAAAACAACTAAAATTTTTAAATATAACTTTTTATGAGTACATATAGATG
GCAACAAAAGTATATACAAAAGAAAACAGGGATGATGGTTACCTCAGGTGGAGGAAGGCA
AGGGGGTAGGTCGTAGGGCAGGGGGTGGGGAAAGGGTATGATATGACTAACGTAGGTTAT
TTTCAAGGTTCTAGCTTTTATTTGGTAGGTTCATGGCTGCTTATTAACATCATTTAAAAT
AACTAATTAAGTAACTAAAAGAAAAAAAAGAGAGCCATGCATGGACCAATGATGAGTGAC
ACAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACAAAACAAAGGCAT
ACCTCTCAGCCATCTTACTATGGTGCATTGCCTCAGCGTGTAAAAACCTCCTGGAGTAAC
AAACAAAGGTACAATTTGAAATATTGATATTGGGAAGCTTTAAGGCATCATAAACCCGCC
AAAGACTTTCCTTTCTGTGTCTGCAAGTGTGTGTGTCACGAGATGTGTGGCTTTAGCCCC
TGTTGGGATATTCTAAATTCAGCCAGACTGCAGAACTCTGGAGCAGGGAAATGAGTGTGG
CTGCACTGCTTCCACCCTGATGCTCCTGTGGGAGAGCCCCGTGAGAGGACAGTGGAGCAA
ATCCATTAACCAACCAGGGCCTTTGTTCCGTCCCACAGTTTAAAGCTAAGAGATTCTTTA
TGGATTACCTCGACACTCATCTCTAGGAAAGATAAAATATTACCCAATAAATAGCTGAAA
CGTATAGGTCAGTGATGCTGACTCTGGATACAGCACCAATGTCTTCCAGGATGACCCAAT
TTTTATGTGCTTTTCTGAAGGTTCAAATACTGGCTCAGCCACTTACTTACTGTGTCTCAC
TAGGCAAGTAACTTGACCTCTGTGCCTCAGTTTCCTTATCTTTAAAAATGATGAGCAATA
CAATCTGCCTTACGGGGTAGAGTAATACATGTTACCATATATAAGCACCAGACAGTGCCT
CTCCCAGAGTAGACACCATATTCATGTTTGATACCATTTATCATCATTCAACAAGATAGT
TTAAAACTACTTTTATCAAATCAATCATATTTATTCCAATTACAATTGATCACATTTTAT
TTTATAAACTGTTCAGTGCTTTTCCCTTGCTGTTAAAAAAATTATAGGCTAGCTGTCGAT
CTAATTCACTTGTTAGCAAAATATGCTCTTTTCATTAAATATATCAGAAAAATCTGACAC
CACATCTAATACACTTAATGTGGTTGTTTTAGTTCTTTAACATCGCATTCTCATTTGATT
ATTCAAAAAAAAAAAAAAAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved