Canis_familiaris Locus Mono:48:SNORA5
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:48:SNORA5
Canis_familiaris
Mono:48:SNORA5
8
SNORA5
1001..1135
2135
GTATGTAAAGTCTGTAATGTACAATTTTGGTCTCATTCACCACAACAGAAATTTTAGTC
TCTTAAAGAACATCAGCCATTTTTCTCAAATCAGAAAACAAAAATTGAATTTACTTTAAG
GTGAAAATAAATGCAACTTGGATAAAGGAAATCAGAACTGAAGTTTCCTAACTGAATTAT
CTGTGGTTTTGTTTAAAGAGTACTGGTCCAAGGGCACCTGGGTGGCAATATGGGTTGAAC
ATGCAACTCTTGATTTCAGCTCAGGTCATGATGGGGGGATCGAGCTCCACATCTGGCTCC
CAGCTGGGCATGGAGACTGCTTAAGATTCTCTCCCTCTCCCTCTGCCCCTCCCACCCCTA
CCTCCATCCCCTTGCATGGCTTGCTTGTGTGGGTCCACTCTTCCACGCTCTCTCTCTTAA
AAAAATAATAATAATAATAATAGAGTACTTGTCCAGTGTTTATGAAGCAACTTTTCTTTA
AAAGCACTACACTGCCATCTGCCATCTCAGGAGTTATTTTTCTGGGATTATAGCTGACCT
TAACAATTTTCTTTGCTGTCAATTTTTATGATTAATTTGATAATCTTCTGCTGATATGTT
AATAATATAGACCTTCTATTATAGCAAACTATCAAGTTTCATTCTTTGCTTTTCTTCCTG
ACCATTAATTAAAAACAACAATGTACATGATTTCCTAAAATTCAGTAGGTTTACAAATTA
GGCTTTTTATACCAATTTTAATTTCTTCTAATTAGAGAGAAAAATCACAAAATATGGGAG
AGCTATAAAACAATACTATTGGGACATCTGGGTGTCTCAGCAGTTGAGCATTTGCCTTTG
GCTCAGGGCATGAGTCTGGTCCGGAGGTTGAGTCCCACATCAGGCTTCCTGTGAGGAGCC
TACTTTCCCCTCTATGTCTCTGTTTCTCTCTGTGTCTCTCAGAAATAAATAAATAAAATA
TTTTTTAAAATAAATAAATAAAACTATACCATTACCATTACTGCAGTCAAGTCAAATTCA
GCTCCCATTCCCATCATAGTGGGAACTGGCCAAATAGCCACAGCAAGCCCTGCAGCTTGT
GGGCTCTGAATCCCCTGCCCTGGGACCTGGGGATAAAAGTTTGGCTGCAGACAGGACAAA
AATAATATTAAATTAAATTAAAATAAAATAAAATATACCATTATTCTGTCTTCAAGAGTT
AATCACTGATAACATTTTGTCATCCTTTTCTACCTAATGCATTTTAAGTAGCCTTTCATG
CAATTAATCAACAAATCCATTCCCAGTCATGACAACAGTGGAAAGTCAGAGCCAGCACTA
CAGCTTGGGAGGGCCCTCAACTAGACTCTGTAATAAAAGTTGAGGAGCCCTGAGCCCTGT
GACTCAACTGGAAACCCTACTATTAATTCTCAGAAGTTAAGCCTGAATTTTGGAGTGGTC
ACAAGACAAGTGCAATGTTTTAAGCCTGGGTTTAGGGTGTAATGTTGTAGCCTCCTGAAT
TGAAAGATATGAGGGTTAATTTTTTCTGTCAACTTGACTGGGCTAAGGGATGGCCATATA
GTTGATAAAACATTTCTGGATACATCTGTGAAGGTGTTTCTTAAAGAAATTAGCATTTGA
ATTGTTCAAATGGGTATAGTAGATGGCCCTGTCCAGTATAGGGCATCATTCAATCTACTG
GAGAGAACAAAAAGGTAGAGGAAGAGCTAATTCACTCTCTCTCTCTGCTGGAGCTATATC
TTGACACAGAGATAGAGATACAGAGAGATTGAGAGAGAGAGAGAGATCTTATTGGTTCTG
CATCCCTGGAGAACCCTAACACAGAAGACAATGCAAATATGAGCATGAGGAAGTCAGAGC
TCCTCTGCCTTGCAGGACCCCCACCCATATGAACCAGAGGACCCACAGTGAACTTTCACA
TGGACTAAGGAAAGCACACAGTAGGTTATCTATTTTACCAAGATAACCTTTGCTCTCTCT
ACTTAAAAGCCTCCATTCTACCAACTCGCTAACATGCAGAAACCTTGGGTTTCTTCAGCT
TGGAAAAGCAGCATTTTACAGAGAAGGAAATAGAGTCTCTAAATCAACGAAATTATGACT
AAAGTGGCCTTTGATCAATCACATCATCAGAGATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved