Canis_familiaris Locus Mono:146:SNORA48
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:146:SNORA48
Canis_familiaris
Mono:146:SNORA48
13
SNORA48
1001..1135
2135
TACAAGCCACGGAGTAGGAGAATATATTCATAACATATATGGCATTTTTTAAAAAGAGG
GCTAGTATCCAGGATAAAGAATCTAAAAAAATAATTGAGAAAAGGCATACAACCTGATAG
GGGAAAAAATGCACAAAGATGTGAACATGGACCTCAGAGGGAAAGATACCCAAATGGTCA
GTAAACATGAAAAGTGCTCAACCTGATTGTTAATCAGGGGAATACAGATTAAACTCACAA
TGAGATGGAACTAATGCCAATGTGTAAAATTGAAAAGACTAACAATACTAAGTGTTGGCT
ATGGTGTGAAGATTTAGAAACTTATACTCCTGGTAATAAGGACACACACCAGTACACCTG
CTTTGGAAAACAACGTTGCATTATCTAGGAAAGTGGAATATTCCATGTCCCTGGAGATAT
GCATAATTTTGTGCCCTGAGGTAAGTAAAAAAGAATGTCTGTAGCAGTGTTTTTCATAAT
TACCAAAAACCAGAAGAAAACTAAATGCTCACTATATAGTACACAGACAGCAAGAAAAGG
AATATTTTTTTAAAAGGAATACTTTAGATGTGCGCAACAATATGATGAGTCTTGCAGTGT
TGAGCAAAAAAATAAAGTCACAAAGAATAGTATAATGGAGCTCCATTTTCAGACACTTTA
GAAACAAGCAAAATTAGGGACGCATCCACAGACAATAAACCTACAAAGACAAGCTATAAA
AATAAAGTGGTCACTCTTGGGAGGAGGGAGCAGTTGTTACCCGTAAAGAATATTGAGGGA
GCTTCTGGGGGGCACTATTTGTAAAGTGTTTCCTTGCCCAGGGCATGATTGCGTTCGTGT
TCACTTTACACCCATTTGTTAAACTTGTCTATGTAGTATATTTTAAATTTAAAAATGCTT
AATAGGGTTTTTTTTTAAAAGCTTTATATTTAAATTTTATTTTATTTTTTATTTTTTTTT
TTATATTTAAATTTTAAAATGCTTTAGAAAAAACTACCCAAAGTCTCTGACCTGGGTAGA
GTGGCATCTGGTTGGTAGTGCCTGCCTCATATTAGCCAGGGACAAAGCAACGCCTTGTTT
ATCCCAGCTTGGCTTTTGGTCTGTGCCTGTGCCTAGTTCATGCCCTGGACATGTGGATTT
AAAAGAAAGAAAGAGAGAGACAGAGAGAAGAAAGAAAAGAAAGAAAAGAAAGGAAGGAAG
GAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGAAAGAAAA
AGAGAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAGAAAGA
AAGAGAAAGAAAGAAAAAGAAAGAAGGAAAGAAAGAAAGAAAGAGAAAGGAAGGAAGGAA
GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAAAAGAAAGAAAAGAAA
AGAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGACTACCCTAAACTCCAGCTAA
TTCTAAGATGCAATGAATATTTGATATTGTAATGAAATAGACAGATCTAACTATCCAAAC
ATGCTGTGCACATTTATTATCAGAAATAAGCTTTGATTCCTGTAATTTACATTTCGTTAA
TTCTGGACTTCATCAAGAGTAAAGCCCAAATGGCTTTCACCCAGCACCAGAGACCAAAGA
GGCTTCAGATTAATTTACATCTCCTTTGGGCTACTCAGATCTTACTATAATGACGATGCA
TTCATCAGAATAAAAATGGAGGTAGGACCCTGAAATCCCAGGACTTCAAAAAAAAAAAAA
AAAAGTGAGGAGAAGATTGCCTCAAAATAAGAACAAAGAAAAACAAATGGCCTAGTTTCC
ATCACTGCTGACCCAAAGGTCATGATTTACCTGCCTTTGTTCTTCACAGTTTCAAGTTCC
AGAGTGCGCATTTCACAAGCTTGGTATATTTAGCTGTCTTCTGGAGGCATGTGAGTTATA
AATAATAGTGGCTGCGAACATGGTTAGGACCTTGCTGATTTGCCGTTTTGGAAAAGTATG
TCTTTTAGAAAATCTGTTAGGAAGAATATTCATATAAGTCCATTTTTACAGAAGGAAGAT
TTCAGAAAGGATATTTAAATGTGGTTTCCAAACACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved