Caenorhabditis_elegans Locus C05D2.6
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C05D2.6
Caenorhabditis_elegans
C05D2.6
3
CeSSU-970
2253..2377
4828
TTTAAATTTAAATTTAAACTGTTTTTATTTACCAGAAAACTAGAAAATCCCAATGAGAA
AGAAGGGAAATTAATAGAAAAATAAAGTTTTAAAAATACCTAAATTTTCTACAGTACCCG
AGGTCTCGCGAAGATTTTGGTCCGCAGTACGCAAACACTCTTATGCTTGTTTACCGTAAC
CACTGAAATATTTTTTCGTTGTTTTTCTTTATTTAAAAAAAGTTATCTATTTTTCGAAAT
TTATTGAAAATTTCACATTTCAAAACCGTCAATAATTCTTTTAAAATTCATTTTTCGCAA
TATGGATTTTCTTCAAATGTTAAACCAGAGTTTTCTTGTAATTCCTTGAACAAATCACAT
TTTTAAATCACATAACCATTTTCGTTTCTGGAAATCTTCACTTTGAAGTTGAATTCTTGT
TAGATTATATTTGTTTAACTCTGAAAAATAGTTAAAATGTGTGTTTTTATATGTTTTGTT
TCAGATTTCCCCTGCTTTGTTTTCCTTTCCTAGACTAAGTTTTTAAATTTCGATCAATCC
TTTTTCTTCATTTTACCCTCTCAAAACCATTTATTTACTCACTTGAGAGACGCAGAGAAA
CCATCGATGGCCTAGATGTCTCGTCTCGCCTCCTTCTCGGCCACGCGCGCCTATCTATCG
ATGTTTTTCTGCCTGTTCGCTCCGTTTTCTTTTTCGAATCTTGACCGCTTCGCATGCCTG
TTCCGTTGCGGTTTCTGAAGCGTTTCGGTTGCGTCGCGGTTCCCGGCTCCGCCCTACTAC
CCGTTCGAGTCTCCCACGGTCTGTAGCACGTCTATCACCTATGTGAATGAGTGTGTACGA
TCATCTTCTTGCCAATCGGGTTATTGGGTTCAATGGATCGTAGATTGATATGAAACTCGA
ATTCGGGAAGGAATCGCCACGCAACGCAGCTAGAAATGCTTGAGAAACTTGCGAGAATTT
GAGAAGAAAATAAATTTCAGAATTATTATTAAAAATTTCCAATGAGCGACCGACGGCGGC
ACGGAACAGAGGATTATCAAATCGCCGGTCTCAAGCATTCAATGACAAGTAAATCGATAT
TCATAGATTCAGAATTTCCAATAATTTTTCCAGGTGTCGCCTCAAGCTCCCACGGTGGTG
CTGGAGACCTCCAACAACAATTTTCCAGGGAAGATCCACCCGTAAAAACTACGCAATACA
CACTTGTAAGCTGGAAAACGTTTAAAATTCAAAATTTTCAAATTTTCAGCTTCAACTAAT
CAATATGGTTCGAGAAAATCCGATTCTCTACGATGAGGAGATGCAAGCCGCCACGCCGGA
TGCTCAGTTGAAGGTTCAGAAACGAGAAGCATGGGATCGGATACGTGCTGATATAGTTTG
GCAGGACATCACTCTTGTTCAGGAAGTCTGGTCGGATCTTCTCGATCAATATGCTAGAAA
ATCGATTGATATGTCCGATGGACTAATTGAGGCAATGCGATGGACAGATTCATTGATTTT
TAAGAAGAAATGTAAGAGTTTCTTGCAAAGAAATACACCAAAATCATTTATATTTTCAGC
AGACTCTCGACCTCCTTCACAGCTCACCGCAATGTCCTCCGGACTGGATAAGGATTTCTA
TAATGACGTTCCGCTGGCAGAAGATGTATTAGAACCCGGACAAAGTCTCGGAAATTCTGA
ATCCATGAAGTTCGATTATGTGGTTATTCAGCCTCATGTTAGGCCACATCAACAAATTCC
CACATCTTCATATTCCCGTCGAAAATCACCACAATCAAGAGAAACAGAGGCAATTGTTCG
AACTTATCCATTATCGCCGAAGCGGATAGTGGTAAGTGCAAAAACGATGAAGTAATTACT
ACTCAGACCCTAATTTTTCCGATTTTTGCTGACTATGAGATAACCGGTCTCGTCACAACA
ATTTTTGTTAAATACGACAAGATGCGCGCCTTTAAGGAATACTGTAATTCCAAACTTTTG
TTGCTACGGAATTTTCATCGATTTTCATAGCTTTTCAACAAAAATTTGAAATTACAGTAC
TCTTTAAAGACGCACACTTTATTGTATTTAACAAAAATTAGTCATGTCGAGACCTGGTAC
CGTATGTTTGGCGCAAAAATCGCAAATTTCACGTCTGGGTAATAGCAAAGGCAAGCATTC
AAAAACCCCTTACCGGCCTCGCTTGCGGTGATGCACGGGTGGCCTACTGGCTAACACTCT
CGTCTGCAAAGCAACAGTCCACAAGTTCGACCCCGCTTCATGGTGCATTACACTTTGTAA
CTTGCATTGTGTGCGCGACTAATGAAGCAATACCAATATCTGCAGTATCTGCTCATTCGC
CGTGTTGTAGTTGATGAGCTCGTAGTCCGATAACAATTTTTTGATTTTTTTTCATTCCAG
CAACAGCATCGTATGCCACAGAAGAATAATCCAGACCAACAACATCAAATGAATGAAGTC
AAAAAGGAAGTTAATCCGTTTGGACGACAAGGTGTATTGGTGGAGGTGGAACCATCACCC
TCCTATGCTCAATCGAATACGAAAATTTACAAAATGGTCTCCGCGCATAGAAGTGCAACG
CCGCAACCTGCAGTTACAGTGGCTTCATCTAGAAGATTGGTACATATGGTAGGAAAAAAT
AATTTATTTAAATAAGAATTAAATTTTCAGCCTCACCGAACAAACTCCCTGGTTTATGAT
TCGATGCCAGAACTTATAGATTCGTGAGTTTTTTTTTTACTTCTTAAACTTCACTTAATA
AAACATTTCAGTTCAAATATGCCATCGGAACCACCAAAAAAGAAAATACACTTGGAAGTG
GGTCATCGAAATAGTGAAATGGTCGGTGTATCAACCTCATCAAATGCCCCGTGTCTACCC
AAAGAAATTCTAACCGATGGAGTCCCAATTGCCGACGATGAGATTATTTTAGAAGCTGAT
GGAGAGTGTAAAATAGGTTCTGGAATGCTTCTGGAATCTCAACAATCAAGTTCACAAAAT
CATGAAATGGATATGCCATCAACTTCAATGGATCATTATCATCATCAAGATATTGGTAAT
TTTTCGCTGGAAAAATATGAATATTGAATGAATTTTCAGATGATGGGGGTGTTGGAGATG
ATATTGAGCAGCAAGTGGTGGTTGGAGGACCTTCTGATGAAATGGCGATACAATATGATG
AAGATCTCGCATTTCAACAACATATCAATAGTGTCTTGAACAGGTTATCTGATGATGAGG
TAATTTTTGGTTTTTAACAAAATTTACGCGGAAGAGTTTTAAAAATTCGATTTTTCATTA
ATAAATTGGAGTTTTATACAAAAATTCGAATTTGGATATAAAAAATTTTTTATAGGAAGA
AATGTCATTTGCTTACAAAATTTAAATTTTGAGAAAAAACATTGAAAATTGTGGACAAAA
ATCGAATTTCTCAGAAAAAAGTGAAATTTTCCAAAAAGAAAAAAATACAAGCAAACTTGA
AATAATCCTGGATTCAAGTCTTGAGTTACACAGGAAAAATTGTTTTAAAAAATGAGCTAA
AACAAAAAAAATCAAATTATGTTCAATATTTGTAATAAATCAGCCTAAAAATCATTGAAG
TTCCCATTGAAAAATCACCAGGCAAACTTCAACATCAATATTTAACTTTCGAAATATTAA
AAAAATCTATTTTCAGAAATCCGTGATGAAATTCAACATGCAAAAAATTATACTCGACGC
AAGATTTGGCTTAGGCACAGCCCGAAATATGCTTAAACACGATGAGATGCTGGAGGTAGA
GTCACACGTGGAAATTGATCCGAATCACGAAGTTCCTGAAGAGATTTAGACATTAATTTG
ACGTACAATGCTTCTGTAATATTTAATTTGTTTTTTTCTTTTTTTCTGAAAAAAATCCAT
CCTTCTCCCGAAATCAATCATATCAGTGAACATAACGTATTCTTTTTTCTCTTTTCTCCT
TTTCTCTCAAAAATATTTATTTTATTTTTTTCGAATATTGTCATTTGTCATAATTTTCAG
ATGAAATCAATAACATTTTTAATTTTAACAGGAATTGAAACCTTTTTAAATATGGATTTG
TCGTCCTTGTGAATATTTATTTTCTTCTAATTTGAATTTTTCAGAATTAATATATAGATT
TTTTTTGAATCTGCCTCAAAATAATGGCTTTTAAACCTAAAACCCAACAAAAAATCATTT
TTAAATTAAAAACGGGCTGGCAGTGAATCTTTTTTCAATAAAAACTAAATTTAACAGAAT
GAAAGAAACCTAATTATCAGGAAAATTTTGGAATTTATGAGAGCAAGTTTGAAAAAGGAT
GAAACAAATTTGCCAATAAGTTTTGCATGTTATAAATATTATTAATTTTGCAGTGGGTCA
ATGCCACAATCGGAGAATTCAAAAGATGCCGAAAAAGAGAAGGTGATGCGTTCACGACGT
GGTACTGTCGATACAGAGATCAGCGGAGCACTCACAGTTCTTCAGAGCTCATTGGACGTT
GACGATGCTCCGTATCGAGCCCGTCTCTATCAGCTCTTTGGGCACATTGAAAAGGAGTTT
GACACATTGTATGCCGAGAATTGTGCTCGTTAGTTTATGATTTGCAGCCAATCAAAACCT
CAATATATCAAGTTTCAGTACGTGCTCGAATTGTTCAATTGACACAAACTGAAGGTGAAG
CAGCGAATGTTGTGGCGCAGGAGGTTTTTGGAGTTCAAGAATCTGGAAAATCAAGTCGAA
AAGCAATTCAAATGGGTCAAAAGTTGCGAACAGCTCTTCGAGGACCTCCAGTATTCCGTG
ATGGATCAAAATTCCGATTGAGTCGACTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1113..1204, 1249..1510, 1559..1830, 2400..2627, 2670..2722, 2771..3054, 3099..3238, 3676..3828
1001..1067, 1113..1204, 1249..1510, 1559..1830, 2400..2627, 2670..2722, 2771..3054, 3099..3238, 3676..3828
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved