Caenorhabditis_elegans Locus Y43F8C.7
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y43F8C.7
Caenorhabditis_elegans
Y43F8C.7
V
Y43F8C.22
1861..1998
4753
ATTTAGTTAATTTAGCGAAAAATCGCCTGTTTTCCATGGAAATCAAGGGTTTTCCCATA
AATTATCAATCATTTTTCAAGAAAATTTGGTTTTTCGCTGAGAAAATCGGGATTTTCCTT
GAAAATTTGGATTTATTTTGATTTTTCCTGGAAAACGTGGATTTTTCGCGAAAATTAGGA
GTTTCTGGCAAAAAAACGGGGCTTTTCTCGTGAAATTTACGGTTTTTGGTGAATTTTGGA
GAAAAATGGGTTTTTTTCCCGTTATTTCCGGAGAAAATCGCTTATTCTCCGTAAAATTCA
GGTTTCTTTTGATTTTTTTCCGGAAAAATAGACTTTTTCACCGAAATTCGAGCGTTTTCC
GGGGAAATTAGCGTTTTTTGAGCTAAATTTGACGTTTTTCACTCTAAATTCCAATTTTTC
TTGGCAAAAATCGCAATTTCTCGGCAATTTCCATCACGTACTCCGAATTCAGCGCCGGAA
CTTTGCAAACAGCGTTGAATTTCAGTCCAAAATCAATGTAGACGTCTTCTTGAACGCGTT
GAGCGATTTTTCCGACGACGAGGCGCCCGTTAAAGTCGCCGAGTTGCATGAATTTCGAGT
TTCGCAGCAGAGAGGCGAACGATTGGTTCTGAAAATCGAAAAATTCGCGGTTTTTAACCC
CAAAAATCGTGTAAAAACCTGCGCTTCCGAGGTTTCAGTGACAGTGTCGACGAAATCAAT
GATACTCTCGTTTCCCTGGCTTGTGGAGAGAGCTCGGAGCTCTCGGAGCCCGCAAATCAC
CTGTCGAGACTTGAGCAAGCTTCGGAGCATCTGAAAAATACAGTAAATCAATTTTTTCGG
TGAAATTTGCAGTTTATTAAGGGAAAATCCCTCATAAACGAGTAACTGTCGTATAATTAA
ATGCCTGGTCCGCAACGGTGTTTGCGTACTTGTCGACCGTACCCCTCTCATCGCATTTTC
CATTATTTGAAAAAAATCGATAATTTAACTCAAATTTTCTCAATTTTCGCAATTTCAGAA
TGATTTTCAAGCCGATTTCGCTCATAATTGCGTTAATTTTGCCAATTTTCACACTTGCCG
AGTGGAAAATCACGCTGGAATATAGTTTGAACGGTTTGTAGTTGGAAATTTGATTTTTTC
GGATTTTTAACTAAATTTTCTCTCGTTTTTCAGAATTCACAAATAGCTATCCACTTGGAA
GCATTGAAATGAGCCGCGCATTCGACGGAAACTACACGGGAACCTTCAAACCGGCTCAGG
AGCAAAATTTCGGGCAAAAGTATGGGGATTTTCCGGTTTTCTTCGCTTTTTTAGCCGATT
TTTTGTGTGAAAAATGCGAAAAATAGCATAATTTCAGGCTTTTCGAAGCTCAAAATGGCG
TTTATTCGGTTCGAGCACGGTCGAGCACACAACCCGGACAGAATTTCCTGACGACTAGCG
ATCCGGTCGGTTTTTCGACTTTTTCGGCGAAAAAATCGAGAATTTCGGTGGAATTGGAGT
GAAAATGCAATTTAAAACTGAAAAATTGAGTAAAATTGGTGTAAATTTCGTGAAAAACTA
TGGTTTTTCGATTTTCCCGTGGAATTTTGACTGGAAAACAAAAAAAAAATCGCAATTTTT
CCCGAAAAATTCGAATTTTCAGTCATTTTTCCGCGGGAAAATTAAAATTTTCACAGTTTT
CCAATGCTAAATCAACGAAAAAACCGGATTTTTCCGATTAGAAAACCCTTAAAATCCGCA
AAAATTCGACCCCTCGGCCACCGCAGCCATGTCTACGCCCTCCCTCACCTCGTACAAGTT
GCTACCCGTGGCTTAGTGGCTAACGCGCTCGCCTGCCGCCCACAGCTTCCGGGTTCGATT
CCCACCCACGGCAACAAATTCCAATTGTGTGTAACATTCAATGCAATTGAGCCGACGCCG
TGGGAAATCACTTTCGTGGAACCATTTGATCCCACGCTCGTTACTGTTAATGATTGTGGT
TTGCACGTGGTTTACAATTTTTCGCACTTTTTTTAAAGGTTTTTACGGGATTTTTGTTTG
AATTTTTAACCAGAAAAATTCAAAAATTGGCTAAAAAACTTCTGACAAAATGACAAAATG
AACACATTTTTAGTCAATTTTCGGCGGGAAATTTAAAAATTCAAATTTTCAGTCAATTTT
CCACCGAAAAATTCAATTTTTTCACGGAAAATGCCAAATTTTCACTCAAAATTGTGGAAA
ACATGATATTTTTCGTGAAAAAATCATATTATTCCAGAATTTTTGGCGTAAAAATGCAAA
AAATCAAAAAAAAAAATTTGCAAAAAAAATTTTTTGTTTAAAATTTCAAACTTTTAAACG
AAAATTGTGACTTATGTGTGCAATTTGGCAGTTCCCCCGAATTGCCGAATCGCACCCATT
TGTCACCGGAGATGCGGAAGCTATGCCCAAATTTTCCATTTTTTAGCATTTTCCTCATGT
TGTCGTCTTGTGTAAAAATTGTTGAAAAACAATGTTTTTGTTAAAAAAATGGAGCCTTTT
CTATTAAAAATTTCAAAAAAAAATTTTTTTTTTGGACTAAAAAAAATTCTCAAAAATTTT
TTTTTTTTTTGATATTTCGAAAAATTTCATCCAACGTTTTTCCAACCAATCCAAAAAATT
GTGACTCATGTGTGCAATTGGTAGATTGGTGGCTCAAAATCTAGAAATCCGTAGGTTTTG
TTCCCCCGAATTGCCGAATCGCACACATTTGTCACCGGAGATGCGGAAGCTATGCCCAAA
TTTTCATTTTTTGGCATTTTCCTCATTTTTTCTGAGTAAAAATTGGTAAAAGACAATGTT
TTTGTTAAAAATGGAGCTTTTTCTATTTTTTTTTGGACTAAAAAAAATTTTTTTTTTTGG
ACAAAAAAATTAAATTTTTTAATTTTTGCAGTGCCTCTTTCTCCACTCCAACCTATTCCA
CGTCTTCTGGCTGTCAATTTCTCAAGAAAAACAGCAACTTCACACGCTGACAATTTTCCC
GGATACAGTCGCCTGGCGTAGTGACACCGAAGACGGAAAATATCATTCCGAGGCGAAATT
GTGCAAAGATCGTAGTGCAAATGTGCTCCAATCGACACAAGGAACACCGAAAGGAGTATG
CCACGTTGTTGGCGAATCTGTACTTCCGACACCCGATACGGCGGCTTTTGTACAGAAAAT
GGAACGGGAGAAACGCGCGAAACAGCACGGAGCTGATGCGGATAATCGGAGCTTTTTGGC
TAAATATGTACGGAGAAAATGATGCGGAAAATTTGACGTTTTTGCCCCGGAAAATTCTGG
AAAAAACGGACAAAATCGTGAATTTTTGGCTGAAAAATTGATTTTTAGGCTCAAAAAATG
GGTTTTTACTGATTTTTTTCCGAAATTTTGCTTTTTATTGGTTAAAATACTGCGAAATTA
AAAAAAAACGATTTTTACTTTTTTTTTTTTACCCAAAAAAAATGTGTTTTGTTGCAGTGG
ATGTACATTGTTCCAGTGGTCCTTTTCGCCGTCATTTCGAGTGCAGTCAATCCAGAAGCC
GGAGCCGAAGGCGCTGCTCAATGAGCCAATTAATTTAAATTTTTTTTGTTAATTTTGCCC
TAATTATTGTTGGCTTTACCCTTTTTTCCCCAAAAAAAAAAAAAAAAAATTTTGCTCCAA
AAAATTCCAAATTTCAGCTCGATTTCGGGTCATTTTGTTGTAAATTTAATAATTTTTCCC
AATTTTTTATTAGAAAAATATAGATTTTTAATGCTTTTTTACACATCTTTTCAATTTTTT
TTTCTCCAATTTTTACCTGTTTTCAACAGCATTTTGTACCTATTTTCCCCGTTTTTTTTC
TTTCCAGGTTTCTTTCAGGTAAAAAAATTTGAAAAAGTACAACTTTTTGTCCAAATTTTC
CCAAAAAATTGCTCAAACTTGAAAAAAATTGGGTCTCGCCACGAAATTCCCAGGGTTACT
GTAGTTTTCGTGGCGAGACCCAATTTTTTTCAAAGTTTGAGCAAAGTAGGTCATGATTAT
ACTTGTTTCAAAGCTCTCGGCGAGCTGAAATCGAAAATACAAGAAATTTTTGGAAAATTT
GGAAAATTGTTGGGTCTCACCACGAAAATGTTTTTTTTTAAACTTTTTGACTTTTTTCAG
AAAAAAATTCGAATTTTTGCACATTTTTAGACCAAAAAAAACCGGAATGAACTCACGAAA
TTACGAGAATCAACAGCAGCAGCAGGGAGGCCACGTACCGCCTGTGGCAAGTAATACGGT
CACAATTGGAACATCTGCCAATTCACAGGTAGATCATTTGCCGGATTTTCAGATTTTAGA
TGGAAAATGGCGAAAAAACGCGGAAAATAGACTGAAAATTCGAGAAAAACGACGGATTTT
CAGCCAAAAACTGGGGAAATTGAGAGCAAATTTGGCAAAAAAATATCGAAAAATTGATTT
TTGAAGCCGAAAAATCACAAAATTGGCTGAAAAATCAGGAAAAAATAACAAAAATGTGTC
GCAAAATGTGTGGAAAATTGCTAAAAATTCCCCAAATTTTGCCGGGAAATTCTGAAAAAT
TCACTAAATTTTCCAATTTTTGCGCGAAAAATCTATGAAAACTCGCAAAATTTCCAGAAA
ATTTGAAATGTCCCGCCAAAAATTGGGGGCGGAGCCAATTCTACAGTACCCCAAAAAAAA
AATTCAAATTTCAGCCGAATTTAGGCTCCGCCCATTAAAAAAATTCAAATATATATTTTG
GATATTATACTACG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1173..1278, 1357..1444, 2911..3246, 3477..3753
1019..1112, 1173..1278, 1357..1444, 2911..3246, 3477..3560
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved