Caenorhabditis_elegans Locus W08G11.3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans W08G11.3
Caenorhabditis_elegans
W08G11.3
V
W08G11.6
3539..3675
6417
CTCTTCTATTTTTCCAAAATGCTCTCCGTCTCTGCGTCTCCTTCTTATACACACTCTCT
CGTCTTCTGCTGCTGGATCGAAACCATTTTATTTGAAATAAAATCAATCGATAATTGTAC
ACACACAAATCCCCGAAAACCCGCTAAATCACACACATTACCCACCCCACCCCAACCAAA
AAATAAACGCCATCATTAATATTATTTTTCTCTTTTTTTATTATTTTTCCTTTTTTCCCC
CAAATTTTATTGAATTTCTTCCATTTTTCGCCCTCTTTTCTGAAAATTCGTGTTTTTGCT
CACCATGTCTTCGTGTTTTTCTTTTCCCTCTCCACTTTTCCCTTTCTCTCTCTCTCTCGT
CGTCGTTTTCCACATATTTTATTCCAGATTTTTCTCTATTCATAATATTTTTGTTGTATC
CCAAATTCTATTATCGAGTTGCGAACAAATGGTGATTTTTGGCGGAAAATTAGGGTCTCG
CCGCGAAAAAACAATTTGCTACAGCACCCCTTTAAAGGCGCACGATAGCGTCGAGACCTT
TTTTAATCAAAAATCGATATTTTCTCCGCAACTGGGTAATATTACTGAACTATTTCAGAT
TTTTAAATATACATTTTTTTGTGCCCCGTTTTATTTTTTTTTGTATGTCTGTTGTCTCTA
GTAGTATCAAATATCAATACCAAAAATAATGTATGGAATATTTTTTAATATTAGTGTTGT
AAAGATCCCCCTCCTCCTCAAAATGTCCCAAAAATTGCGAAGAAACAAAAAAATTCACTC
TCTCCCCCTCTTTCTCTCTCTCTCTGTATGAATTTTTTGTATTTATATACACAAACATAC
ACACACACATACACACCATATATCGATTGAATTGAACTTTTTCCCCCAAATTTTGAATTC
TTTGTGCGATTTTTAGACGAATTTTTTCAGTGCTCAGAGACTGACATTATTGTATCATTG
ACACCAAAATAGTTGGAAAAAAATGGAAAAGAAATTTTCAGAAATTTTCAGACAAAACGG
GTCATTATCATGGACAGCGGACGACGAAGCCGTAGTGGATCGAGAGATAGAGATAGTAGA
CGCAGACATAAGAAGGTTGTGGATTTACGCGGGATTCGTGTACTCCACGAGGAAAAGAGG
ATTTTTTCAGTTTTTTTTTTGGCAGGAATTCTTGATTTTGGATCATTTTCGCTAATTTTC
GCTGATTTTTTCTAAGTATTTTTCTGTTAAAATCCTAAATTCAAAAAAAAATTTACGAAA
AAAAAACGCAAAAAGTAAGAACGAGCCGCGACGCGACACGCAACGCGCCGTAAATCTACC
CCAGATATGGCCGAGCCAGAATGGCCTAGTTCGGCAAACTCGTCCATTTCAATTTATGAG
GGAAGCCAGAAATCCGTGAAAAATCAGAATTTTGTGGATTTTGATGAGAAAAGCTGAGAA
ATTACTAAAAATATTGAAAAATTGTAATTTTTCCCAAAAAACGCCAGAAATCGAAAAAAC
CAGAAAAAAATCCTCAAAATCTGTTGATTTATTCAAAAAAAATTTTTTTAAAATTCCAGA
AATTCTATATTTGCTTTCTAAAAACTCCAAAAAAAAAGCCAAAAAATTTTTTTTTGAAAA
AATCGAAAAAATCCTCTTGCAAAAATATCATTTTCCACGAGGAGTACACAAAGTCCCAAA
AATTTCCGTAAAAATCAATAATTTCAGCATAGACACAAGCGTCGATCCCGTACACGGAGC
CGCAGTAGATCATACGAACGGAATGGAACGGCTGGAATTCATATTAATCCAGCTTTTGGG
TTGGTTTTTTTGTTATTATTCAGGTCTCGAAACGATCGATTTTTAATTACAAAAAGGATT
ACTGTAATTCCATATTTCTCGATTTTTATAGGGGAAAAACCAGGAAAATTTCGCGAAAAA
TTGCCCGAAAATCGGATTTTTCCAAAAGTTTCAATTTTCAAAAATTTCAGACTCCCGCCT
GGAACCGTACAACCACAACCAATGGGCTACTCGGCGTCACAGCTTTTGCAGACGAATAAT
ATGTTGGAAGCCGAAATTCATCGGCTGAAAGCCGCGTTGAACGCCGCGCAAGGCGGTCAA
CAAATTGAAGCTCAGCGGTGTCAAATGCTCCAACAAGAATTGCGGTGATTACATGAATAG
CTTCTTCTGCTCCTTGAAATGGAAGAGTTTTACCGCGGCCACGACCGCGACGCAGCTGCA
TGCGCGGAGCGGCTCATCAAAAAAATTAGCTAAAATGATAAAAAAAATCACAAGCCGCTC
CGCGAGCAGTTGCGTCGCGGTCATGGCCGCGGCCGAGGTTCCCAGCTCTGCCATTTCAAG
ATACGAGGGACTCTGGAAGGCCATGCTTCTGCTGAAAAATCTTTTTTTTTTCTGTTTTTC
GAGAATTTTTTAATGATTACTCAGATAGTGATTTTGCTTGATGAAAATATTACGCAGCCG
CAAAATTTTTCGAATTTCGTGTCAAAACTACGGTACCCGGTCTCGACACGACAATTTTTG
TTAAATTCTAACGGTGTGCGCCTTTAAAGAGTACTGTAGTTTCAAACTTTCGTTATCAAT
TTTTCATAGATTTTTCACGATTCGTAAATATTTAGGGGTTTTTTTACAAATAAATTGATT
TTTCACAGTTTTTCGATAAAAAGCGATTTTTTTTGTTGAAACAACTCAATTATTTAGAAC
AATAAAAACACCTAAATATCTACGAATCGTGAAAAATTGATAAAATTCCGCAAAAATGGG
AGTTTGAAACTGCAGTACTTTTTAAAGGCGCACACCTTTTCGAACTTAACAAAAATTGTC
GTTTCGAGACCGCGAATGTCGCATTTTTTGCTGATGTGTAATATTTTAGGAGAATTATAG
CAAATATCAAGAAAATTTGAAAAATATATCGATTTTTTGCTCAGAAATGCTCAAATCCAA
CGAGATCAAGCCAACAAACGATGTAACGAGATAATGTCCGAGAGGAGAATGATGAATGAT
TCGAAAGTTGAAATGGCAAATGTAAGAGCTGAAAATTCTCTCAAAAACTGGCAAAAAATG
GTTGAAAAGCAAGAATTTTAGCCAAAAAATGTGAAATTTTTCGAAAAATGAATTCTTACT
TCTCCTCGGGGAGTACACGACCTGCGTAAATGGACAATAAATGTTTATAATACTTTCAGC
GAATTAATGGACTAGAAGTGGCGAATCGGATGCTCCGAGATGATGTTACCCAGGCGAGAA
ATGCGACGGAAGCTAAAGAGGAGGTTTTTATATATAATTTAACGGAAAATTTGAAAACCA
AAAAAAAAATTCCAGGAAATCCGAGCAATAACGTATCAATCAGAAATTGTTCGCCAACAA
ATCAACGCTCTGAACGAACGAAATGCGGCGCTCAAGACGAAATGCGAGACGGTAGTGGCG
CAAAATCGTCAGCAGCATGAAGAGTAAGTAGACAGCACGGAGGCTGTTACACTGGTGGCG
CAGGCGGTAACGCGCTTGACTGCCAGACGGCTGGGGTTCGGCTCGACCCCCGCTGCCGCA
TGCACCTTGCACTCTACGCCTTTCCTTTCAATGGGTTGGTATGATTTAATAAGGATGCAA
GAGAATAGTACGGGAAGTTCGAAGACTTGCGGATTTGCTTCCACGGCTCCGCGAGTTCAT
AACTGTCACCACAATTAAAAAAAATTTTTTTTTTCTAATGGAACGCATTTTTAAGACGAG
ATTTCAGAATGGAAGCCCGTCAAAAGTTCGTGCAAGGTGCTCAGTTAAATGTGAAGAAGG
CGGAGGCGGATTTGCAATTGGCCAATGCAGAAATTCAGTGAGTTTTGAGTTTTAAAAAAA
GTTTAAGTTTCAGAAAACCGTAAACTAATTTCAGACGTCTGCTCCGAGAACTTGACAGCT
CTCAGCAGCTCGAGAATTCGAGCATCACTGACAAAAGAAATATCGAAGAAGAGCTCATCC
GGAAAGAAGATGAGATCAGATTGGCAAACTACAAATCAGCAACCTTATTAAAAGCGGCAA
ATGATAAAATCGAAAAACTCGAGTTACGATTGAAACAAGAAAAACCGGCGGTGCACAATG
AGATGACTGTGGTAGGTTTAGCAGGAAATTGACAAAAAACCGGAAAAAATGGGAAAAATT
CTAATCACTTTCACAAGTTCCAGGAAACAATATACATTGCCATAGAGACTATCAAAACGA
CGTACGAGAAGCAGCTGTCCAGAATGGAAGAAGAAATTGAGCATTTGAAAGCTGAAAAGT
TGAAGCAGGAGCAGCAACAAATAATGATGGAGGAAGAGGAGGATGCAGTGGTTCAGAATC
TCGAGGAACTTCCAGCCTATCTGAAGACTCCAATGAGGCCGGATCCAACGAAGATGGAAG
GTCTTAAAAAGACTATTCAAGTGAAGATCAGGCTTGATGAAGAGCCCGAACGCCCGGCTC
GGCCGGCTAGTGGACCGCCCGTAGATTCACCTGTGACGTGGCATCAGAGAAAGCCGTTCG
AACGGCTCCCAGCGATGGTTGTGCCGCTTTTTGGGACAACTGAAGGTGAGATATTAATCA
GGCGCAAAAAATACTGTACTCGGTCTCGAAACAACAAATTTTTATTCAGTGAGAAAAGGC
GCAAAAAATTGTCGTGTCGAGACCGTACGTACCGAACTTTTGGTGCAAAATTTTACGTCT
GTGTGTGTCAGGCTGTCCCATCACGGTTTGATCTACACAAAAATGCGCGATTTGTTTGCC
TAAAAAGTGTGACGTCAGCACGTTCTCAACCATGCGAAATTAATTGAGAAGTCTGCGGCA
TTTTTTGTAGATCTACGTAGATCAAGCCGAAATGAGACACTCTGACACCACGTGAAACTG
ACATTTTCAGCACCATCAACAGGACCCGGACCATCCATTTCATCCGAAGATCTCATCACT
TCCTCGACAATCGAATCAACGTCCGATGAAATTAGCATTGCCGCCTGCAATCAGTTCTCT
GAGGAGGATCTGCTGCTCGCCGAGCCAACTGATATGATATCACCGAGTCAACTATTGGAT
CTCGATGAGCAGACTCTGCTTGGTGGAGAATAATTTATATTTGTATTACGGGGCTTTAAA
ATTGCTTCAAAATTCCCAAAATAGTCTGAAAATATTTTTTTTGTTTGGAAAAAAAATCCG
AATTCATTTTTCCGAATTTTTTTCCCGAATTATGCTGAACAGCTCCCGCCGCAGATTAGC
AAAATTATCAACACTTCCCTTTTTAACAATTTTTGATGATTTTCATACTATTTTCGGGAG
TTTTTTAAAAGCAAAATCCCGTCCCCCGCACCCAATTTTTAAAATATTCATTCCCTCGTT
CCCCCGATCTGAATTTGTTTTACGGTTCTCCGTGCGTGTGTATGTGTCAATTTTAATAGT
AATTTTGAATCAATAAAGTTTTATTATAATAAAAATTCCCTCAACATCGATCTCTAGTAC
TTGACTGCACAATTTTGGGCGCCATTGACACGGTGCTTTGGGATTTCTGAAATACACAGT
TTTTTGGGTGAGCTTTATTCGTACACTGCCCGGTGTCAATTTACGCGGCTCGTGTACTCC
TCGAGGAGAAGTGGGAATTTTTTTTGGGCGTAAATCTTTGATTTTGCACTAATTTCGTCA
ATTTTTGCAGTTAACGTCGAATACAAAAAATTTGGCGAAACTGCGCAAAATGAATATTTT
CGGCGAAAAAAGTACTGCAAAATCCTCTACAAAAAATTCACACTTTTCCACTACGAGTAC
ACAAGCTTCGTAAATCGACACGTGGCCGTGGAAGAGGTTTTTCTCTGCCATTCTCTGCCA
TGAGACCTACCTTAAACCGGCAACAAAACGCGCTCTGAACATCCCGATTCATCATTAATA
GCATTATTGGATTAATAAACGATAGATTGCCAGATAGTGTTGGATAAAAAAGACGTAACG
CCCGTACTCGGTCATTCTGAATAGGTTACTGTAGGCACGGTACGGTAGAACACACTTACA
TCGGCGTCGGTTGCCAACACATATTCTCCAATGTAGAAGAAAAACGTGACGATGCAGAAT
AGAACGAGGATGAAAACGTGCAGTGTTAGGCGGGCGTCTTTTAGTTTTTTCGTGGTTTTT
GTACTGAAATCGAAACTGAAACTTGGTGCGTTGAGGGATTTTTGAGAAACGCGGACCGGA
AATATGTACGGTTGAGGGGCTAAAAACACAAAAATAAGTGAAACAATTTCACGCCTACGC
CATGCCTCCCTCCGTGCCTATGCGCCTACCTTCGTGCCTGCCTGCCTACACAGACAAAGA
GTTACGACTTGGGCTTCCAGTTAGGTGCCTTAACACCCGCCTTCAAGCCTGCCTTCTGCC
TACCGTCGCGACACATCTATACTTGGACGCAAACCACATAAAGTGTCGGCCGCTGCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1094, 1707..1798, 1970..2143, 2924..3020, 3179..3262, 3315..3442, 3727..3816, 3874..4090, 4163..4544, 4870..5417
1029..1094, 1707..1798, 1970..2143, 2924..3020, 3179..3262, 3315..3442, 3727..3816, 3874..4090, 4163..4544, 4870..5069
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved