Caenorhabditis_elegans Locus ril-2
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans ril-2
Caenorhabditis_elegans
ril-2
V
C14C10.8
3177..3307
4764
ACTGAACGTTGAAAAAAAATTGAGAAAACGACTTTCGGGTTTCAATGTTCACAAAATTT
ACATAAAACTGGATGAAAAGTGTTGGCCTTTTGTATTTTCAACAATAGTTCCTGGACCAT
TTTCTTGTACGCCGTAAATAAAACTTGACTTTAAACTTGATAAGTAGTGTTTTTCAAGTT
AGCAAAATAAACAATATATCAGGAGAATTTCATTCTAAACAAACAAAAAAGTTTTACTAA
TATCTGTCTGAATTATTTTTATTCGGAATTTTAAATGATGACAATTCGAAATTTTACGAA
AAAATAACGTTTTGGACCCCTGAAAACACGTGACTGGATTTCAACGAACGGTTGTTTCAT
TTTTGAACCAAAAAATCTGATAAGCTTCGAAAGTAACTAGGAAAACCAGTCTCGTGAGAG
GGTCGTTGTTGTCAAAAAACAACCCTCTCAATATGTCATGGTTTTCCACACGAGAAACGC
GTCAGCACGGAAAATACGCAAACAATGACGCCTTTTTTATTTGAATTGGAAAATTAATGA
AGAAAACATGGATTTAATTGGAACTGATTTCAGAACAGGCATATTGTTTATATAAGCTGC
ATTTTCTCGCAGCGGGGATGAAATTACTGAAATTTAAATAAAGAAACTAAACTAATGTAG
AGCAGAAACAGATTATTAACTGATCATGTTTTTATGAATAATGTAGTCAAAGTTTTATCG
CATTTTTACAAATGAAAAATAATTAAAAGCCAGAAATGAAACTGAAACTTGTTTTTGCAA
TCGGAACAAAAATACATTTTTTTTAATGCGAGAGAGTGTGATTAAATGAGAGGCGCCAGA
AGTTTTTGTGCAAACACTATGACGATACACCACACTTTACGAACAAGTGCACTTGCGCGG
AGTAATTTTTTTCAGAAGTTTTTGTTTTTTAAAGCATGCTCAAGCGATTAATTGTTGATT
TCTTGCTTTTGATATAGTATATAATATTTAATATTTATTTCAGGTAATAAATTCCTACAC
AGGAATCTGAGATCAACACAGATGATCAGGAGAATTAGTCAAAAATAGTAGAAAAATGTG
GCGATTCGCAGTTTATACGCAGAAAGCAACGTGAGTTCCTCTTGTCTTATAAATTATTCA
ATTGGAGTTTAATTGTTCTCTTATTCTAGAATTCTGAACAAAACATGCCTGACAGCAGTA
AGACAATCACTGAAGCACACGGATGGCCGATTTGATTATTTTAGATAGTAAGTTTTTGAT
GCACCGCTAAAGAGAGACTATAATCAAATGTTTCAGTTTGGGAAACGACGCATCTCATGC
CATTTCGGTGCAAAAAGATCAGCAGATTCGCGAAGTGTATGTACTAACATCGAAATATGT
TTATTAAAATGTTCATTTTCAGTTTTTCCCTCGACGATTTTGGTCTTCTTTCTATGAAAT
CTCAATCTTTGGAGTCGATAAGTTCTGCAGGCAATGAGCATAATTTTCTTGATCAACTCT
TCCGCAATGACACACTGAATGCATTCTCAAACGTTCAAATTCCTACGACCGTGTCTTCCA
AAGAACTTGGTGGATCAAATGACATTTTTGGATACGATTATGTTTCAGAACTTCTTTCGG
AGGGTGCGATTCCAGAAGAAATTGCTGAAGACCTCGCAATGAGCACATCTTCTACTGACT
TGGACGTACTTACATCTTCTTCTGAACCGGCTTCATATTATGATGATCAGGAGCCAAGTA
CATCTGGGTTAGAAGTGACAAATCTTCCTTTCTTGATGCCAAAAATTGATCAACAAAGCA
AAGAAAACAGAGATTCAAGACAATTGATGTCTGAACATATCAGAAGAGAAAGAAAACTAA
ATCTTTCAACTACTACACCTGTGAATGAATCAGATGCCCAGCTGTTTCACGTACCCGAAT
CTCTGAACTATCAAAATATTGGCCATATGCTGTTCCCGGACTCGTTGCCACCGGAAACTT
ACACCAGTCAATGGAAAGAAGGCGAATTACCATCGATCTCCAGCCAAATTTCATCAACTG
AAACTTCTTTCGTCGACACAGCTACTGAATTTTCTTTAGAACATCTCGAAGATTTGATCG
CTGATGGGGCAGTAGATGAACTTCATAAATTATTGAAATCTTTGCAAACGTGGCCTGAAT
GGATGTTCACTGGAAATCGCCAGGATATTGTAAGGATCAATGATGTTTTAAGATTCATTG
TTGAAAACCTCTGCTCTGAAGAATCTGAAATAATTATTCGAAACTTGTAAGTGCTTTCTT
TTTTTTTTAAAGTAAAATAGTAATCCATTCAATTTATTTTTCAGCTGTGGATCACATGTT
CTCGCGGAGATTCCAGAAGATATAATTATTCATTTCACTCTCCGAAGCATCACCCCAGAA
TGTGAAGTCTCTTCAATCATGAATAATCTGGAAACCTCGTCTCAGTGGGCACATAAGCGG
GAACTTCGTCCGAATCGAATGCTTGTCAAAACTCGACTTTCCGAGCTCTACGCGTTTGCA
ATTCAGAAAAGCCCCGAAAAAGCGTTGTCTCTATTTTCTCTGTGCTCTAAACTCAACCTC
GACCGAACGTCCGACATTTTCATGAAATGTTATGGTGAGACCCGAGCATCAAGTGACAAT
TTTCTCAAAAGTTTCGGAGATTGGAAATTGTTGTCAAATAAGTACGGAACTCAACAAGGA
ATTGATGATTACTGGATGGCAGCTCTGAAATCAGATGCAAAAGGATTAGACAAACGCATA
GAGGCGCTTTTATTGCATTCAGGGAAAGGTGAACATCCATTTGCAACTATGGCTCGAATG
ATTTGTACTTTACTAAAACTGGCTAGAATTGATGAAGCGTTAGAAGTTTTCCAAAAGGTT
TCCGTATCAGGAAAACATTTCAAGCAACAACTTGCCTCGTTTGTCGAACAGGTAAAAGTA
AAATTTAATGTTTTTAATAATACTCGATTTTTATAGAACGATTTGGAATGCATCGAACGA
CTAGCTATGCTCGTAGAAAGAGGAATGATTGCCGAAAAACGAAGAGGCGGCGGCGGCCGG
TCAGCAGTCAACAAAAGCGTTATTGTGAGCGTGGTGAGCGATCGATTCGATGGCCGAGTG
GTTGTGTCCTCAGCTAGCAATTTATTGACCTACGCTCAACTTCCACAGTGGCGTTTAAAA
GCAGTCGTTCAGTGGCGCAAGCGATTTTCCCATGCGCTTGTGCCTAATCTTTGACTGCGA
GATAAAAATGTCAGAGTCAAGCGGTCCGCTATCTGTGTAGCATTCTGTTCAAGATTTGAC
TGATATTTTATTCATTTTATTTTCTATTTTCAGAAATGTCTTGATGAAGCAGTCCATGGT
GTCCTTGACAAATTCTACGGCATTGGTGGTCAGAAAACTAAAAAGTTTGTGGAGAAGAAC
ATAAAAAAGAAGATCCACCGAGTTGATGAAGAACAGTTGCATGAACTATGCAAGGCAATT
CAAAGTGCTTGGATTCAGTGCTCTGACTCGAAAGAATCGTTAGAACGTCTTTTCGCGTGG
TGCCAAACAAATCGAGTCGAAGTTGATCAAAGAGCTCAAAAGAAACTATCTTCTTTCCAA
AAATAGATATGTCTAGGTAGTATAAATATTAGATTTCTAGTTTTTTTTCTCATTTTTTTG
TTATCGTTTCACTCCTACTCTTGTTATACCTGTTTTTTCTGTGCCTTCATTGATTTTTGT
GTAATTACCGTACCCGGAGAATTCGAATGAAACCGATTTTCTAAAATATAATTGAACAGT
TTTTGATCTTGTGTATCCATTCACATATGATATTTTGTCTGTTAATTTGATGATTGATTT
TAAAAACTTATTTCACAGATGCTCGGGTTAAGTAGAAACGGCCTGCGGTCACTTGCAAGG
AGACGTGGACTATCTTCTGCTGCTGCTCAAGTGATTATTCTCAATTAATATTGTAATCCA
AATATTAAATTACAGACTACAAAAAACACAGCGACACCACCACCACTTAAACAACAACAA
GAACAGTCAAATGATGGGCGTAAAAACTTTATGAACAAAACTGGCAAACCATTTATCACC
ACAACATCTGCAGAGCAAATAAAGCTTCAGAAGAAGTATCAGGAGGGTTTGGAGAGCAAT
AAGTTGGAAACACTTCATGAAGCAGTTGAATAGTTAGTTTCAAAACTAGGCTCTATTCGA
AAATGCTAACATTTTTTGCAGCATTGAATGGCGCGGCACTGTTTTCCCGCAGACCGTATC
CAAAATTATCGGATTACTCGAGCGTGCCGCTGATCTCTCCACTCTTTCTGATCGTCAATT
GGCAGTTCTTTTATCGATCTTCGGCTCAACTTGTGACACATTGTCCCGTTCACTTCGTGC
TCAAAATTTGGAGAAAGTTGAATCAATTCTACGAGAAAAAGGAGTTGTGTTGGGTCTCTT
ATCTCGAAATCAGTTGATCGAAGCAAAAGTTGATAATCGCAGTCGTGTGGATGCAGTTGA
AGAGCTTGGAAAATTTGAAGAATCTGGTATCGAACTCGATGGAAAATCCTATGCTCTTTT
ATGCGAAGTTTATGCGAAACAAGCAAACACAAAAGCTATCACAGACATCATCTCTCACAT
GAAGTCCAGTGGAATTCCATTGACAGAAGATCACGTCGCCCAACTTGTCTATTCAGTCGC
CAGAGGAGGAAACTATGAACATGTTGGTCGAGTTGTTGATACATTCTCTACTTCAATGAA
TGTTGTCCGTCTACGATGCGCTGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1169..1246, 1296..1355, 1402..2265, 2324..2930, 2976..3092, 3333..3764
1075..1109, 1169..1246, 1296..1355, 1402..2265, 2324..2930, 2976..3092, 3333..3602
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved