Caenorhabditis_elegans Locus inx-11
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans inx-11
Caenorhabditis_elegans
inx-11
V
W04D2.7
2821..2887
5763
TGCAATGGAGGCTCAATTGTACTATGCATTGTGTTTTTTGTGTTTTTATTGGGTCTTTC
TATTATGTTATGCACTGCGATTGCTTACCGTAATGATCTATCTATAATCATCTAGGTTCC
TACGGAATGTCCTGGTTATGGCATTGTCTGAGATTCTGCTCGAACATTGCATGAAGCTGA
ATTCTTGCAATTTTCGATTATGAACTAGTGCTGCAATTTATTGAGTTTTTCTTGGCCAGT
CTTTGTCAGTTTTTAATTCAAATGTTCAAGGAGTGAGAAAACTTTAGTCAAAGCTTACAC
AGAGGTCACTCTCCTTGATCAACTTTATTATTGCTTGTAAGAAAGTAGATCTTAAGAGCT
TCCATGAAAAAAGTTTTTACTTGAATGCCGGAAAAACCGTAATTTAGATTAAAGGCCTAA
GTTTCTTTTGCATCTACACCTTTGGTTCACAGAAGGTGGAATGTGTGATAAATGTGAATA
AGTACCTATTTGGCCTTTGCCTCCAGCTTGCCCAAGTTTGGCACAAGTTTGGCCCAGCTT
TTGCCAGCTTCTGAACCAAGTTAATTTGTTTTGGATGAAACTTGAGCAAGAAGTCGCCAG
CGAATGTCGAGTTTGGTAACCAAACTGTTGTCTACATTAGAGACCGCAATGAAACGAAAA
CAATTATTCATTTCCTGCATAAATTTTTATATTCTTCCTGATGCTTTATCCTTCTTCAGC
TCCACCTATTCATCACGTGGTATGCTCTTTTGAATTATGCATAGTTCACTGCATAACCGG
CAGATCAAACTTCAAAAACATTTAGCAATAATTTGTTTGTTCCGTTTGGACATGAAAACA
ACTTTTTTTTTTCAAATATAAGTATGCATTTTAGAAAAAAGTTTCGACCCGAAACATTTT
AAAACTATTTGATTATATTACATTTTACTTTTTCTGACTCTGATTCCTCTTTCTTTTTAA
CTCTACGTTCAACCTCATAGTCAATCCTCTCAAATTTTCAGTCATCATGGTGATGATCGA
AACATTCCTCGGAATGGCGAAATATCTTTCGCCACGAGAGGACGATGATTGGTCAGATCG
ATTGAATTATCTGATGACTCCGAATATTTTATTGGCATTCTCTGTGCTCATCTCATTCAA
ACAATTCGGAGGCAGACCAATCGAATGCATGTTTCCTAACAAATTTCCTGGCAGTTGGGA
ACAGGTAGATATCATTACTGTAGTATTTTTTGGGTCTAAATATTTTATCGGCTAACCTCT
TTCTAGCGCTATAAATATTTTTTGAAAGTTGGATTCATGCGCTGGAAAGACTGTAAGAAT
TTCCAAATTGTTCTGGCTCTGAGATCAAGATTATCCAAAATTGATTTTCCTATGAATCTT
TTTATCAAGCTCTATCAATTCTCAATTTCAGTACGCGGAAAACTATTGTTGGTCCCAGGA
TACGTATTTTGTCGAGCCAACACAGGATGTATCCCTTTTGAAAAAAGAAGAGAGGTTTAT
ATATTTCATTTGCTTATTTTAAATTTGTTTTAAGTTTTTTTATGAATAAAAACAATATTT
CAGATATACACCGGATCGACAGCTGTCTTATTATCAATGGGTTCCATTCTTTCTTCTACT
GCAGGCTGCATTTTTCAGAGCTCCAAGTTATCTTTGGAAGTATTTCTCAAATCATTCAGG
TATTTAAACTTTTATTGATTTTACTAAACGTAAGCCTAAAATTTTTAAGGAATTCGAATT
CATGAAGTGGTAGAAAAAGCGAAAGATTCTGCAAATGTTGAAGAAGAAGTTCGAGAGAAG
AATATTCTAATTTTAAAGAGACACTTGTCAAGTGCTCTCAGATTCCAGGCTAATATGGAG
AGAAAGAAAGTACAAGTACATAAAACTGTAACTTTTCTCAATTTTCAATACTCTTCTGGT
TTCATTTCGTGGATTTATCTCTTCACCAAAGTGCTCTATTTTTTGAATGTATTTGCTCAG
TTGTACCTGATGAATTAGTAAGTTTGATTTAATTCAAAAATATAAGTTCCATTATCAAGC
TTGGGGCTTATAGGAAGGTGTTTTGTCATCTAAAACGCGTGAAAACCTTAATTTTTGAAA
GTGTGACATCAAGATAGTTTTTTAGTATAGCTCTTGTACAGATTCATGAAGTTCAAACTC
CCATTCCTGCGGTTTTCATATTTTTTATATTCTTTCAAGTACTATTATAAATATATAGAT
TTTAATAAATCGTAAGAGAATTATGAAAATAAGAGTTTAAAATTACAGTAGTGTCGAGAC
CTGGTACCGTATTTTTTGCGCAAAAATTGCAAACTTGGCGTGTGGGTAATATGGCTAAAT
TTCAGTTTCCTGGGCACTAATAGACATCATTGGTACGGATTTGGAGTTGTTCAGGACATT
GTTCAAGGTGAACCATGGGAGAGAAGTGGTTACTTTCCCAGAGCTGCTGTTTGCGATTTT
GAGGTGATTTCTACCATTTTCAGAAAATAAAAACTAACGCTGTTTCTTCATCTAGGTCCG
TCAAGTTGCCAATATTCAAAGATATTCGGTTCAGTGTGTTCTTGTGATCAATATTTTCAA
TGAGAAGATTTTCGTTTTGTTGTGGTTTTGGTGAGTACACATTATTTTATTTAGAATTAT
AAATTGAAAACCATTTGTTTAAATTATTGAATCTAAAACATCAAAGCCTTGTTTCTTTTC
TCTTTCCAAAGTTGAATTTCTTACGCCCCGCCCATCTCACACGAGACAAGCGGTGGAGAG
CGAAACCCGCCAAGTGTCGGGCGCGCTTGAACACTACCATCAGTGTCTCACTAAAATCAT
TGCTTCTGTGATCGACAACAAACCCAGCTCTCTGAATGATTGTGAGGTTAAGAAAACAGC
TGAGAAGCGCTGACAAAAAAATTTTGGTATTACATCTCTTACAAGGAAAGGAAGTCAATC
TAGTATCGGACTTTAAATTGAGACGCATGTCATTTGAAAGCTTATGGTTATCCTAGATCA
CCACAAAAATTTTAGCGGCGGAACTCAACTCTGAACCCCTGAAAGCGCCATCTGAAAATT
TTTCTCTGTGCCCTCCTAGTTTTCAATACTATTTCGTATTTATTCCTTTTACATATACAA
AAATCATCTTCAATATTTATAAAATGGTTCAAAACATTGAAAACAATAAAAAACAGGGAT
TGATGGCCAAATGGTAAATGCTTGGTAAAACGGAATAAAGGTCTCGTGTTCGATTCTTTC
AGTGGCAATTTTTTTTTAAATTTTTAAAAATTGCAATCGCGCCCTGAATTTTTATAGCTA
ACTTTTAAACATTTTATTTAGTAAAAATTAATTGCATGTGAACCAAGGAACCATTTAATT
GAATAATCTCAAAAAAATTTTTTTTTGGGATTTAAAACTTTCGAACTCAAAATTTCCAGT
CCCACATATTTGACCGAAAGTAGGAGCATGGCTTGTGTTTGGGTAATGTAATATGTTGCA
CCGATGCTTTTTGAAGGTTTGAATATGGCTTCGGACCTTTTTGTGAAAGAAAAACGTTTT
CAAAGGTACATCCATTACATATTTGAAGCAATTTTTAAGCTTAAAAACCACCTCATATTC
GGTGCAAAAGGCTCAATTGGAAGAAATTTGTACCTTTTTATATGCCCCGATACAAAAAAA
TAGTTTTGAAAATTTTTCAAAAAAAAAATTTTTTTGACCAAAAATTTGGCTTCCGTGGAC
CGCAAAAATTTCAGATTTTTTGCAAAAAAATAAAAATTTCCAAAAAGCTTCCACATTCTT
TGTTTGACCCTAAAGACCCCCAAAAACAATTTTTAACCGCTCATAGCCACTTTTAAGGCC
ATTTACTTGACCTAGAATTCAGCAAAAAAATGCACTGGAGCACTTTCAGATGGCTCTTTC
AGGGGTTCAGAGTTGAGTTCCGCCGCTAAAATTTTTGTGGTGATCTAGTCTAAACATAAG
CTTTCAAATGACATGCGTCTCAATTTAAAGTCCGATACTAGATTGACTTCCTTTCCTTGT
TAGATGCTCATAATTTATTTTAGGTACGTGATTCTTCTTCTTTCGTCGACTGTTTCACTT
GTCCAATGGTTCATCGTTCTCGTTTTTCCATGCTTTTCAAAATGGTTCGTCAAACAGCAT
CTGGCTCTCAGCACTCTTCAGAATTTCAATCAACGAAACAGTCGGCGTGAAGATTCTGAT
GTTTCTAAGTTTGTGACACAGTACCTGCATAAAGATGGTGTTTTTGTGCTTCGAATGGTA
TCATCACATGCTGGAATCATTTTCGCAACAGACTTGGTGCAGGCTTTATATGAAGCATAC
GATTTTCAAGATAAAAATGTGAGTTTTTGTAATCTATCGAAGCCTTAAAAATATATTTTA
CAAATTTCAGAAAGACGTTCAAGGAAGCCCAGTCAGCGATGATCTACAGACAATCAGCAC
TGGAGCAGAATCTTCGATTCGACAACGGAAGACTAGAAAAGGAAGTCGTATAGAATACAA
GGTAAATTGAAACAAAAATATTATTTCATCTGTAAGTTTTATTCAGGCTGGATTTCCAAT
CAGTACAAGTTTGATGCCTGATAAAGATGATATTGAGTCAAGCTCCACGTCTTCTGAAGA
AGATCAAAAGCGCGTCAGCAATGTTATCACTAATATCTAGTTCACGATTAAATTGTTCAA
GGCAATCCAGCTAACCTAAATACGGGTTGATCCTCACGAAAAACCATTTTAATATTGAAT
TTCACTTTGCGTTCCCATTCACTTTGCTATTGAACTTGTACAAAAATAAAGAATATTAAT
TGTTTTAAAAAATCATAAAAACAATCAACAAAACAAAAATGGAAGAAATCTACCTACGTT
AGACCAATCTTGATCTTGAAAATTGGAATTTACACAAATAAAAATTCAAACTGGAACTAA
ATACGACGAATCTTGCGTGGCCGTGGTCCAAGTTCGCACAATGGAGTGTGATCGGAGATG
CTGACAACATGAACACCAGCAACTGTGAGACCTTTGACACATGTCATACGTCCGGGTCCA
AGACCTTTAACTTGTACTCGAACAGTTCGAATTCCTCTTCTGACAAGTCTCTGTCCGGCT
GCAACTCCAGTTGTCTGACCGGCGATTGTTGTCTTCTTTCTGGCATTTTTGAATCCCTCC
AGCCGGCATGACGTTGATGTGATTACTTCGTTCTGAAACAGAATTGATATTATTTTTTTA
AAGGCCGCTTTAAAATACCCAAAATAGTCTAAATTTCAGAAACACTGCCAAAGAAAAACG
GAAAAAATCGATAAATAATGAAAAATCCAACTTTTAAAAAAGCGATTATCTCAGCTATGG
TAATTTTGAAGCGAATTTAAGGAAATTTAGCCAAAATTGAGAACATCGCATTTTAAAAGT
TGAATCCTTCCCTTTTTGGTAAAGTTTTTTTTCGAAAGAGAAAAGTCTTTTCGCCAAAAC
ACGAAAAAAAACTGAAGACTTAAAATTTTGTAATATGTATTGGAACGTTTTTTTGTAAAA
TTTAAATATCTTGATTAAAATTTAAAATTTTTATAACGTCTTTTTTTTTTGAAAAAATTA
AAATTTAGTTTTTCAGTATATCAGTATTTTTGCTTTTTTCGCTCACTTTTTTTTTGAAAA
ATAAATGTTTTTTAGTCGGGAGAAGGAAAAAAACAAGTTTTTTTTTTGGAAAAATTCGAT
GTTTTGTTTTTTGATCCAAAATTCAAACAAAATTTTTGAGACGGCCCTGATGACGTCACA
TTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1203, 1411..1493, 1563..1678, 1729..1996, 2345..2462, 2515..2609, 4043..4337, 4390..4500, 4546..4763
1006..1203, 1411..1493, 1563..1678, 1729..1996, 2345..2462, 2515..2609, 4043..4337, 4390..4500, 4546..4656
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved