Caenorhabditis_elegans Locus frm-7
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans frm-7
Caenorhabditis_elegans
frm-7
V
C51F7.3
2225..2300
6489
AACCGAGAAAGAGAAAAAACGATTCATAGGATTCTTGGAAATTGCTTTCAAAAAAGCTG
TAAGCTAAATACTTCACTACTCAAATTATTGTAAAAATGCTTTTAGTAAAAATGCTTTTT
AGTAATTTAACCTGGATTTTTCGAAAACATTTTAAACTTTTTTGTTGTTTTTCTAGTCAA
AAATTTCAAACCAGCCACCAACTTCAGGATAATTTCGCAATTTTAATATCTGCAATTTTT
ATTACAGCGTCCAACCACACGTTTTATTTTTCCGTAATAGTTTAAATAATAGCCTAAAAT
TTAGATTTCACAACAAAAATATCTGAAACCTCATATATGCTCCATTTGTTCGAATAATTT
TAAGATCATTTCTCGACACATAGGTTCCGTGATTTATTCGAAATTGCTCATGACATATAA
ATGTTTCATCTTTTGATCTCACGGACAATAATTCGCCTACCAACATTTTTCCACCATTCC
ACCAACTGTTTTATCGAAAAATTTCAATACACACCAAAACTCTAACCATGATAAGAATGT
TGGGGGGAAAGGGGAAAGTGTATATGATTATAATGATAGTGCCCTTCTTTTTTCTTAAAC
AATCTTTTTCTCTCTTTCTCTCTTTCCAAATGTGCATTCACTCTTTGATTTATCAAAAAA
TTTGTTAAGAGAAAAGTGAAGGAATTTTCAATTTTTAGAGCAAACGCCTGCATCACTGAC
ATTTAACACAAGACTAGAAATGTCACGTGAATTCTAGATGAAAGCTTTTTATACTCAAGA
ATGGGTGTTTTTTGTCTGAAATATTTGGAATAACATTGTAAGGCACGGAGGAGGACGGTC
AGGCGGAATTTCGCTTTTTTTAGTTGAAAATGTTTTTTTTTCTTTTCTTCTCGAATTTTC
TGCCAGATGATCATATACCGTTATCATCCCGTGACAATCGTTATCACTTATCTTTTTTTG
TTATTAATCTTATTAGTTATCCAATCAAAATGTCATTACAGAAGTGTGAAGAGCAGAAAA
AGGCAATTAATCGAACAGTACACATTCGGGATTGCTCTATGAGTTTATTCACTGTTCCCC
TCCGCTTTCTCCACTAAATGGACTCGCCGGGCTCAGCGCGCGGCGACGTCACTTCACGGC
TGCCCGTCCATCTACAACAGCCATCATCATCGAGTTTCTCTGATCCAGAAGTGTTCACGT
CTACACATAACATCAGACCTGGACAAACGTTTGTTTCAGTGCAAACTCTCACAAAAGAAT
CGTTTCATGTGGCTATTAGCGTAAGTTTTGTTTTTCGCTGATATTTGGAACTAGATAAGC
ATTCAATGAAAAAGGGTTTTAGGTTCTCAATAGGCGAAGAATTGGTTGTAATTGTTAGTC
TTAAAAAACTACAACTGGAAATAGTGTAACCTAGAATGTTACAAATACTTTCACTCATTC
ATATTTGCCAGATCAAAGAATGAAACTGCAGCATGATGCAGTTTGAAAAAAACTAATAAA
ACAGATTTGGAAGAGCTATGAACTTTAACAAAATGCATATTATTTTCAGTCCAAAACGAA
AGTACACGATGTTCTCTGGAAATGCGGCGAACGTCTGTCACTGTCAGATGACAAGCTATT
TGGCTTAGCATTTCGACAACCAACCGAAGGAATAGGAGGTGATCAGCCTCGTCATGAGTA
TTACTTTTTGGATCCAGCGGCCAAAATTATGAAGTATGCTCAGAAACAACCGAGATTCGC
GAACTGGGTAAGTTTTATATTGTTTTCAAGAAGAGTACATTAAGTGTTAAAACGTATTTC
CTATTTCAGCATTCAAAGTCGAGTGAAAATCGACCAATATTGGTGCTTTATTTTCGAGTG
AGAGTATACATTGATCAAGTTGGATTACTATCGTGAGTATATTCTTTTAAACATGTGTGT
TTAAAGGGATTTTGCCGAATTGTTTAGAGTGACCAATTTGTTATTTGCAGATGTCCAAAA
GCACGAGAACACTATTACCTGCAATTGAAAGACAACTTTCTCGATCATTGGGCAGGACGT
AATAGCGTGTCAGAAGAAAGATGCTGGTACATGGCTGCACTCGCCCTTATAACTGACAAA
GGGAATGACTACCTCGGGTGAGCGTGTGGTCTAGGCGGGTGTGCGCGCGCTTGTCGTTCA
AACCTTGGGGAGGCTTCGTTGGTTCGACCCCCGCGCGTAGTTAAAAGGGTTTTGCAAAGA
AATAAGATCTATGATGAGACTTTCACGACGGTCTTCCGATGTAATACATACCTGTGGATA
TCTTTACGTGAAGCTGAGATCCTTTTTTCCAAAAAGATTTCTCATTAAATAAATTGTTAT
TTTTCATCAGAAAAGTTATCAAACCTAATAAAATTATTTTCTAGATACTTCCGCGCCGAA
CAGTATTTTCCGTTATGGGTGATAAACGAGCGTGGTCTGGAATACATTCGAAATAATCTA
CCCGCGGCATGCGAGGACATTATCAATGAAGGACGTTACAAAGCGATGGAAAAGTTTATG
ATCGAGGCGGGAAGGTCACCGTTCGCACTGAACTGTCATCTCTACGGTTTAAGAAGGCAT
AAAATGGATAATACGGATAACGCGGTGCTCGGAATCAATGCCAAGGGCATTGAGATGTGC
GACATTGGGGAAGATGGAGATAGAATTCCATTACGATCATTATCATGGAGTCGAGTAGCA
AAATTGTCTTTCAACCGGAAGAAGATGACTATTATCGGATCAGATGGAACAAAAATGTCT
TTGTATGCACAAACAGAACACAAAGCAAAATATCTATTAGAACTTTGTAAAGCTGTGCAT
CAAACTTTATTGGTAATGTCACATCTTCATGCAACGATGGCACCTCCACCAAAACCGTAT
CTAGAAATGTCAGTAGATGGAATTAGTACATCATCAACTAGTGGAATTGGAAGTGGAGAT
CATGATAAAGGTACGTTTATTAGAAAATGGGATAAATCATAGATTAATTACATTACAGAT
AGTGATTCACTTAGCAGTGCGTGTGGAGATCGGTGCCATGGCTCAATGTCTTCGAAGCTC
CGTCTTAGAATCAAAATGGATTCGAATCTCGACGTGAAGATCGAGAAGATGGAATTGGAT
CGTAAGTTAATTACTTGAAGTTATATTTAAACAAATAAAAGTTTCAGATATCCGACAAGA
GAGAGCTGCATCTCAATCGAGCAAAGCTAGTGATGAAAGTGAACGGTCTCGACTCGAAGT
TCGCCATCAAACTTATCATCCTGCACACGAACTATCTGGAGCTACATCATCAACGTACAC
AGTTACAACAGCACAAGATACAGCAACAAGACCTTCTTCAATGGATAACGCCTCACAAAC
AATAGAATCGGGAAGCAGTAGAAGTATAGTGGATGTTAATTTCAATAATAAAAATAGAGA
AAGGCACGAGTCATCAACATCGACCAGCGGTACACATGTACTGTTTTCATCGAAGGATGC
AACTCCACCAATCGAAACAGCAGTAGTAAGCAGTACAATGTCAATGAGTGTACCATTAGA
TAGTGACACAAATCAATCAATAAACGATCGACTTCTCTCGATGAGTGCAAGTGATCTTCG
AGCAATGGCAGAACGATCATACTCTCCACCGGCTCAGTGGACAACAAATGTTCCATCGAC
TGGAAGTTCGTCTCCACCAGAAATGATGGCCCGAGACAAACTTACGAGATCGGAGACTAG
AATTGACTCTCAGAATGAAATGTGGTTGAATCAACCAGTTGAGTCATTCAATGGTGGTGG
TACAGCAGGACGGTTTGTGAAGAAAAATTCATCAGGAAATAGAAATGCAAACGCCATCAA
CAGAGTCCATTCCATGCCAAGCCACTATCATGTCAATGGATATTATAGGAACAGCGTAAG
TTTTTAGAATTCACAGTTCAGTCCATAAAGTTTATTAATTTTCAGAATCAAATATTGACA
TATGAAGATGCTCCAATTCATCATGGACCAACATTATTGACCCATGCACAATCTCTCCAT
GTTCCCGGAACTGTAGCTCGTCCACGAAATCCACCACCCTACGAATCAACATTTCAACCA
ATATTTGCTGTTGGCCCAAAAACATCCTCTTCGCCACCTCCACAATCACAACCATCACTA
ACTGCTTCAACTGGACCGCTTCCTGCAGAAATAGCTGGAGACCGACAAGCATCTTTCCCA
CCAGCAAGTGTCACTCCAACACAGTTCTTGGAAGAAGCTGGCGCCTTTTCCACTGAGAAA
ATGGAAAATTATCCATTGATTTTACAACTTCTCAAAGAGCACAGACAGAGCCAAGGCCAA
TTAAATGCAATTACAATGACAAATGGAATTTATAATAGTTCACAAGCTGGAATTCTATCT
CATAATCGGAGACCATCTTCATGCAATGATTTAAGTTCGTTAGATGGCGGTGTTATCAAT
GGAGGAGCTTGTAAGTTAACAATTACTTAAAACTTTAAAAATATTATATTTATTTTCAGT
CGTCCTCCCAACCCATCGAGGTGATTACTACTTTGATTCTGCCACGCTTTCGCAGAATCT
ACATTTATCGAGCTTTGTACCAATGACAACTTCAACAACTACAACCTCTTCTGCCACTAT
GACATCATCACTTATCACAGCTTCATCCCATCAGCAACCACTTCAACCGAGTCAACAACA
TCATCAACAGTTGCAACATCAGCAAAGTATCAAGCCAACAAATAACTTTGCTAGAATCGA
ACAACATAATGGGTTAGTATTTCAAATATTGGTGAAGAATTTTCTTTAATTTACATATAT
ATTTTCAGCGACTTAATCCTACCACCACCTCCTCCATATCAACAACCACAACAGTTGGTC
AACTAGAAATAATTAAATAATCAGCACAAAAGCTCACAGTTCAAGACATCATCATCATTT
CCGACACGTGGTTCTGCAATTCTCAGTGATTCTTTTTTCAACAATTTATATATCTGTTGT
TTTCCAGTTTTTCGTAGAAATGTTCGTATAGAAGACTTGCCCAGCCCTCCCAGCTCACCT
ATATTGCATATTATTTGTACGGGTGTAGAAGTGAAAGTTCTGCTCTTTTTATAATCTTTT
CATTTTCAATCAAGCGTACTTTCATACTCTCCTGTTTGAATAATACGCTTCTTTTTGAAT
TCCAAAATGTCAATGCTCAACAAAAAACCATGCTCAATATCACCCTTGTTTTCTTTTTTG
CCTATTCTGTACAATTTATTGTTTTTTTTGCTCTCACTTATTCCACCCTCCCACAAAAAC
CTTGCCATATTGGTGATTTGCCTCTCTATATTTTTCAAACTTTCCGACAATTTTTGTGTG
CTTGTGTGCTGCTCATTTTTCCTCCGCCGTTTCCCCATAGACATTTCTCATGTGTTCCGA
ACTTCCAACAACGCCTCGTTTCTTCTTTTTTGTGTTTGCAAGTCATAATCATCAACGAAC
CCTTAGCATCAAACAATAAACGGGAGAATTTTTTTATTAAATTTAAAAATGTTGCATTTT
AGGAACATTCTATACAAGCTAACTCGATGATAACAACTGTTGGAACTAGAATTTATCAAT
TGATTTTTCTCAATTTTCCAGTTTATATGTTCGATGGAACCTCCAGATATTTTGGAACAA
TGTTCTAGATCCCAATTTATTCGGGCTTTAAAGTCAAAGATCTTTGTGATCCTCATGACA
CAATAGACAATTTCCTTACGGAAAAATTCAGAGAAACCTATTTTCAAAAATTCTACTCAA
CAATCACATTTGCTTCCTTTCTGAAATAAACATCGATTCTGAAGTATTTTCGGTTCGATG
AGTATTCGCATTGATGTCTATGAGTACATTGTTGGAAACTGATCCCCTCACATATTTTTC
GAAATCTACGTGCAGAATTCATGATATTTCATAATTATTTTCACACCTTTTTTCCTAAAA
TTGTCTGGGATTCAGAATAGGCTTAACGAATTCTTCTTTTTACTGAAATTTCTATTAATA
TTTCAAAATGAACGGAAACCTAACTACTTTCATTTCTTCTGTTATTTATGGTATTCCATC
CGTAGCACTTTATATCACAACTTGCATAGTTATTATCAAAAACAATAAATTATTTGATTC
ATCGTTTTACCAAATTTTTATGTTTGACGGATTTATGAACATTTTCACCTACATAATGGG
ACTCGTCTTCATGCGACTTACCAGTATAACGTGTTATAACTGTTTGATGGCACCAATTTT
CAGACACATAGGTTAGTTCCACGGTGAAAAATTTCGTGCATATACTACTGAAACCTAGCT
AAAAAAAATACTTGATTTTAAACGACCGGTAGTAGATTTCATAAAATTTAGTTTCCAGGT
AATTTTTTGCCCTTAACATTTATGGGTACAATGGCTTATCATATGGCATATGTTCAATAC
GCTTTAACAACTCTTGTTTCTTTGAATCGGTTGACAGTATTGTTTAAGTATAACATTTTC
GAACCGGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1279, 1549..1746, 1809..1891, 1970..2116, 2384..2949, 2998..3120, 3167..3894, 3945..4449, 4499..4751, 4808..5489
1097..1279, 1549..1746, 1809..1891, 1970..2116, 2384..2949, 2998..3120, 3167..3894, 3945..4449, 4499..4751, 4808..4862
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved