Caenorhabditis_elegans Locus F55A11.6
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F55A11.6
Caenorhabditis_elegans
F55A11.6
V
F55A11.10
2869..2959
4164
TTTGAACATTTCATAACGCTCATTTTAATACCGAATGATTTATTTGAACGTTTTCAAAA
GCACTGCTTCAAAATGTATAGTTTTAAAATTAAATAAAGCGATTATATAATGTCTCAATG
CAGCTGAAAATTTGTTCTCTTTTTTTCAACTTTGGGTTGTAGTTATGTTGTGATGATTCC
AATTACCAACTGTGCCTAAGGTTTTCCAAAAATACCAACATTTTGGTGATGAACCAATAT
TTAAAGAAAAAGTTTTAAAAACATTATATTGTCGTATCATTTCAGAAAAGAACAATTTTC
AATATTCGAAAAACAAATGTTCAGACATCGAGACGAGATTTCTTGATATATGGTTGTTTC
GTAAAACTTTAATGGCATTTAGGAATAAAATGTTCTCTTTTGCTACTGTTACCTTTTAAA
AATCCATTTTCGAAAATAAACTAAATTATCAAAAAAATTTTCGATTATGAATCAAGAAAT
CTCAATGGAGTTCTTACATTGGAATTCTTATTCAAATTTGTCCTGTATGACAGGAATAAA
AATGGAAATGCTCTAATTTCCAAATTTCCTCACAATTAAATATTACATACCATTTTCGAA
AGAATTCGTAAAGTTTGGTTTATTTCACATTTCTTCAACGAAAAAAAAATAGAAAAATAT
ACAGGTTTTAAGATTTCAAAAATTGCCTATTTCTCCTAGAAATTAGTTCAATCTTAAAAA
TAGTTTACCTAGAAACAAAACAGACAGAAAATTTGGAACTTGACGAATGTCAATTGCAAG
TCTGCAGGTGTCGTGAAAAACACGAATGAGCTGCTTGATTTTTCTTGATCAGCCTTTCCC
TTGACCATGCTCATAATAGCATTTGAAATCAAGAGACGCAGACAAAGATAAATGAGTTCC
GTCTGTGATTTGCTTTCCCCCTCCAACAACTCATTCCTCACCCGATTTCTCCAAAAAACT
TATTCTTATTGTAATAAAAGAAAACAGAATATATCAATAAAATGACTCCAAGCCTTGCTC
TACAGTATTCTATTACTTATGCCCTTTCTCCAAAGTTCGTGGTTCGTGTTTTCTTCCTTT
TTTCATAATTTAACTCATTGGACGTTTAAGTAGAAAATTGCAATTTTAATTTCAGAAATC
ATCAAGCAGTGGCCGACATCTCAGTGTTTCTGTAAGCTCAACAACTCAGAAGAACTTTGT
GAGTTTTTTTTTCAGAGGAAGGCTCTGCCTGACTGGAATTCTTTCACTTTTTAATCTAAA
AAACGATAATAGTATTTAGAAATTCAATTTCAGTTTCAGCCAAGCCCTGTTCAAAGCCGA
AAGAATAAAATGGACACAATGCACGGATTTCTAGTTCCAACCTACACTTTACATGATTTT
GATGATGGGGAAGAATGTAAAGTTGTCAGAATGATATTCCAAATGTCTAGAGTTCCATAT
GAGTTCAAGCATGTTCATCGAGATGATTACATTCTTGAAGGTATGTGTTTTTTTTTAATT
TGCATGGTTTTTATATGTATTTTTCACCAAAGACTTTACGAAGCAACTACATTAGTGACT
ACTGTATAGTGCAATAATGATTTTTAACGTTGCGTTTGGGAATAATAAAAGAGAATATAC
GGTTCATATAACGAGAACAATATAGATCAAGATTTAAGTATTTCGAATAACAGCTAACAA
ATGTTTTTCCAGATTACCCATTCTATGCTCTCCCAACACTTGAAATGAATGAAAGAAAGT
ACGGAAGTGTTTTGTCAATTTGCAGACACTTGGCTTGGAGATACAGTAAGTTTTGAAAAT
TTTCTGTTTTCATCGTATCTATTAGTTTTAAAGATTTGTCTGGAAAAACGGCATACGATG
ATGCTCAAGTTGATGATATTGCAGAAAAAGTTTTTGAAGTTCGAATGAAAATTAAAAACT
GGATTGATCATATTGAGCATGCGGCTGATCATGCATGTGATGTAAGTTGTTTTTTCTTTC
TTTTTTTAAATTTTGATTCCCAGAAATTTGCAATTGTTGCGCTAAAAGTACGCTTCCTGG
TCTCGCCACGACATGTTTTTCTCCAATTCAAAAAGCGCGCGCCTTTAAAGAATACTGTAA
TTTCAAACTGCCGTTGCTTCGTAAATTCCAGCGATTTTATAGTTTTTTGATAAAAATATA
TATTTATTCAAGATCTAAAATTTAACATTAAAAACAGATACATTTTCACAAATTGTATTG
TGGAAAAAACTTCCAAAAAATATGAAAGTTCCGCAGCATGCTGCGCGCGCAGCAACGTGA
GTTGGAAATTACAGTAATCTTTAAAGGCGCGCATCTTTTTGCATTTGAGAAAAATTTGTC
GTGACGAGACCGCGGTCTAGACCGGGTACCGTTGTTTGGCCCAAAAATCTCAAAATTGTT
GAGTCTAGGCGATGGGTTCAAATCCTGGTTGCTGAAACATGTACGCTTCTTCAAGAACTA
CAGTGTCCATTCCTCGCAAGTTCCTTGAAATTAAAAAAAAAATTGCATAAAAATCTACTA
TATAAGAACCAGAGAAAAAATGCCGAAAAAACAAGATTGAGGTTACTGTAGTTCTCACAG
GTGCTCACCTTTTTCGCGTGAACGATTTAAAAAAGTTTAATTCTAACCAGAACTTACAAA
ATAGTGTTTTCATATTTTTCAAATAAAAAAATATTACAGGAGGAATGTACAGAGGAAATT
GCGCCTCGTATCCTTACCAATACACTGTTTCCTTGCCTCGAACGAATGTTGAAGTCGGCT
GCCTCTTGTTGGCTAGTTGGACACACAGTGAGTGTTGCGCGCATGGCGCAGGCGGTTAGA
TTGCTGAACTAGTGCCTCGCCGTCTGTTCCCGCTAGTTCGACACCTATCGAGCGGTGATG
AATGCACGTATTGCTCTGACACCTCTTATGTTAGCGGTAAATTTCCGTGCCGCGATGAGT
CCACTAGGATCTCTGAGCTCTTTTGAGCTTCACATTTTGAATTTTCAGATGACTTGGGTG
GATCTTCTCGTTGCATGCCTTGTGAATCCGATCATATACCATCGTCCAAAGCTGCTCCAA
GATTTTCCATTGCTGTATTTACATAATGAAAAAGTGGCCCATCATGATGACCTCGTAGGA
TTTTTATATCACGTCAGAACACGTAAATTCCAAGACAAAAAGTAAACGTGACCGTGAACT
TTGCCCAAATCTTTCTTTTTTTGTACTTGCATTAATTTTAAATCATTTTTTCAATCATCG
AGCCGGTTGTATTTCTCGTTTCATTCATTCATTGCTAACTTTTGTGGACAATAAAGAGAT
TAGAAAAATGAGCCTGTCAAAGAATCGCAAAAGTTTGGATTTGGACGATGAAAATGAATC
ATCGGCACACTACTTGCGTTCACAATGGACAGTCTGTGTCAAGTCAGCCAAAATTCTGAA
GAAAGTGACTGTGGTGATGAGAAGTGCAGAGAGAGTTGATCGAGTTTTTGGATCAGCATG
GCTAAAGTCTGAAAAGTACATGACAAAGGTATATTTTTAGATTTATATTTTTAATATTAA
AATTTCAATAAATAGGTGAATGCTACTGATATCAATGTGCCAAAAGGAGCTGTTTTGCAT
CCACATTTTTATCATTTCAATCCACCAATCACTAATATCGGTGAGCTAATTTCATAAATT
CTCCCGAAGTTAACTTTTTAAAATTTTTCCAGGAAAATACTCGGCTCAATTAATTGGACG
TGCTCTTCGTAACCGTGGAATCGAGCCAGGAGTCATATTTTGTTCTCCTACTCTCCGTAC
TCTTCAAACGGCTGCTGCAATCGCCAAATCGACTGGTGCCCGGATTCTCGTTGAGCCAGG
ACTTTTGGAGCCAATGGAATGGTATCGTCGAGCTGGTGCAAAACAATTGCCAGATTTTTT
CGATGAAGCGCTGGATTTCCCACAAGTTGATAAAACTTAGTAAGCTGCAAGATGTTATAT
TAACCTCATGAAAAAATATTCAGCAAGCCAATCTTCTCGATGCACGAATTTACCAGCATG
TTCGGAGCAAAAAGCCAGGAGCAGTGTATTCAACGTATCATGCTAGTTGTGAAAAAGTGC
AGATTCGAATTATAATATTTTCTTGTAATTATGTAATTTCAGTATTTGTGTCATTTTCCG
TGATACTCCTGCTCTAATTATCGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 1135..1197, 1299..1479, 1692..1784, 1833..1960, 2679..2786, 2988..3164
1001..1060, 1135..1197, 1299..1479, 1692..1784, 1833..1960, 2679..2786, 2988..3161
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved