Caenorhabditis_elegans Locus F17C11.9
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F17C11.9
Caenorhabditis_elegans
F17C11.9
V
F17C11.14
2772..2898
4213
TCTTTCAAACGGTATACACCAGATTCTTCCCACCCATTTCGACGGTACGATTTCACACA
TCCTTTTGAAGGAACAAACAGCCATTGACCATCCTTTGACCATGAGAGTTGAATACGAGG
TCGTGAAACACTGAAAAACAGGACATTGTTTAAAACCGAAGTATAACATGAAACACTAAC
TCAATTGTTTCAAATCTTGGGAAAACCTTGGTCAGTGTGTGTTTAATCGAGAATGAATCA
ATGTCTATAATAGTCACATTGCCATCCACAGTAGAAACGGCCACAAATTCATTTTTTGGA
TCCAGTTTGACACAAAGAACTTCAGCTTCAAGACTTCTCGTTTTCAGCTCTGCATCTAAA
TCTTTCATATTCGTGCATTTAACCGCATAATCGCTAGATCCTCCAATAACATTTTCCCTG
TTTGCGTCGACCGTTGTGACATCCATTTGGAATTCAAGAGGATCAATAATATCTCCTGCT
TCGAAATTGCCCTTTTTCGCCCGTCCCACCATTTGCTGCTCGGATCCAACAATGAAATCC
ACCTTGCGGTAACCAAAACAGATGTTTTCTCCATACCAAGCAATAGATGATGTTGTCGCA
TCGGGAATCTCGATTATTTCAGGTTTTTCATCTTGCAGCAACACGTTCTTATTGATCTTG
AGTACATTTCGTTCAGCATCACAAACGTAAATCTGAAAAAAACAGGTAAATATGTTTATA
AATCGTTTTAAATCCTACATTTTCAGTATCTTCTCCTGAAGCATCAATGCAGATAGTTTG
AAGGCCGATATTCTCCAAATTTTTAACGTTAGTAAAGCTCATCTGAAAACAATGGAATTA
CGAGTGAAATTATTTATTTTCATCAAAAATAAATAAAATGCGAGCAAATTTTAAACCTGA
TTCTTGGCGCCGAAATGCGGTAAAAAAGTGTAATGCAACCATGGACCAGTGAACTGCGTA
GAACCCCTATGTTTTGCGTACTGGCATTCTGCCAGGGGCACATACGCAGACTTTTCAGTG
TATTTTTCCTCTGAAGAACACCACTCTTTTCAAGCGCCTCTTCTTTGAGCGTCGCTTCAC
TAGATTCTCCGACTCGTTGGTGACATCATGACCGGAGTAAGTTTATAAAATTAATTTCAT
TAAATTTGCAGTGCTGTTAAGAATAGTTAACGTGATTTCCGTTCGTTGCATTGAAAAATG
ATTAGGCCAAACCTTGAAATGACGAAATTTAACCAATTATTGATTTTTATTTTGCAGAAA
CTGTATGGAAACAAGGACAACTTCAGAACCCAAAAGGTTTTGATTGCTGCCAAGCTCGCC
AACAAGACTGTCACCCTCGCCGGAGATGCTGCTCCAGCTGACAAGTTCCCACTTGGAGTT
GTACGTTTTAATTTATTTAGATGTCAGTATTTGACGATCTGTGAACTATCAATGTGCAGA
ATTTCAGACCCCAGCATTTGAAGGAGATGCTCTTCTCTTCGGAGCTGAGTCGATCGGACT
TCACCTGACTGGAACCTCAGCTAACGCCGAGACTGTCCAATGGCTTCAATTCGCAGAAGG
TTATCTTCTTCCAGCTGTTCTCGGATACGTTCTTCCATCTGTGTCTGCAGCCAACTTTGA
CAAGAAGACTGTTGAACAATACAAGAATGAACTCAACGGACAACTCCAAGTACTCGATCG
TGTTCTTGTTAAAAAGACCTACTTGGTTGGAGAACGTCTTTCTCTTGCCGACGTTTCCGT
TGCTCTTGATCTTCTCCCAGCTTTCCAAGTACACTATGACCCAGATTATATGTATACACT
CCTAATTTTCAGTATGTTCTTGATGCCAACGCTAGAAAGTCCATCGTCAACGTCACCCGT
TGGTTCAGAACCGTTGTTAACCAGCCAGCTGTTAAGGAGGTTCTTGGAGAAGTTTCCCTT
GCCTCATCGGTTGCTCAATTCAACCGTAAGTTTCTTTTTTGTTAGTGTGAATTTGTTTTG
TTCCACTGCGAAGTCAGCAGACTAGTCAATCGATTAGTAGGCGTTACAGTGGTGGAATAT
CAAGATTTATGTACACCGTCTTTGCTTGAAACAGTTTTTGTTTTTGCTTTGTTCGGAACG
TTTTTCATGGGACTGAGAGTTGGAAATTTAGCACTGGTCGTTTACAGGGTTGTCCTGCAG
TCAATTCTAAGTTACCTTAGTTTATGTCCCACACATTTAAAAAGAAATCTAATTTTATAA
AAAAACTTCTGATTTTGTATTCCCAGTTTAAATTTTATTCTTATTTTACAGAAGCCAAGT
TCACTGAGCTCAGCGCTAAAGTCGCCAAGTCTGCTCCAAAGGCCGAGAAGCCAAAGAAAG
AGGCCAAGCCAGCTGCTGCGGCTGCCCAGCCAGAGGACGATGAACCAAAGGAGGAGAAGA
GCAAGGATCCATTCCAAGATATGCCAAAGGGAACATTCGTTCTTGACAATTTCAAGAGAT
CTTATTCCAACGAAGACACCGCTACCAAGGCTATCCCACACTTCTGGGAGAACTTCGATG
CTGACAACTGGTCCATCTGGAAGTGCGAGTACAAATACCCAGAAGATCTCACTCTCGCCT
TCATGAGCTGTAACCTTATCAATGGAATGTACCAAAGACTGGAGAAGTTGAAGAAGAATG
CTTTCGCCTCCATGATTCTTTTCGGAACCGACAACAATTCGACCATCTCAGGAATCTGGG
TGTGGAAGGGTGACAAGCTCGCCTTCGAACTCAGCCCAGACTGGCAGGTAGGACCATTTC
CTCGATTTTGAATGTCGAAGAGTAGTCATTTGTATACGTGATACACTTATACAGAGTTAC
ACTTTTCGTATATAAGTGCTTCTTCTCGTTGGAGTTGTTTATTTAATGAGCAATTACCTC
TAAACTGAAAGCAACAATTTTATGAATTCTCGATAGTTTTCACAATAATATATTTCAGGT
TGATTACGAATCGTACACCTGGACAAAGCTTGACGCCAAGTCCGATGCCACCAAGAAGGA
AGTCAACGAGTATCTTATGTGGGAGGGAGACTTCGGAGGAAAGAAGTTCAACCAAGGAAA
GATTTTCAAGTAAACTGGAGTTTCCATACAACCCGGTGTATTTGCCATTTAATCCTGTTG
TTTACTCTGAGTCGGAAAGAATAAATTGTTTTCTATTGTTTATAAAGGACCCGGTATCAC
TTCAATAAATTATATCTTCTTCAAGTTGAGATTGAATTTATTCGTCTATAAGTGTTCCTA
AATAATTTTAGATTTAAAAATTAGCTCCTAAGCTTGTTTCTTCGTTTTCGGTCGTCGTAT
AGTCCTCGATGTGTCCTTCGAAATATTCTTGATTTGCGTGTTCCAAAAAGCAAGATTTGA
TGTCGTTGAAATATTGTACACATTGCAAATGGTTGATTGAGAGGCTATTGACATCACTAT
CTTGACTCTGTAAAAATCATTGCGTGTCAGTAAAATGTCTCTCAAACCTGATCGCAGAAA
GAGTGACAGTGTATTGGAACTAATGATTTGGAGCAGCATTCCGTGTGGTTTGTTCCTCGT
GCCGCACAAAAATGAATCTTTTGAATTGCAGTCACTGGGCACACTGATTGTTGAAGAAAC
ACTGCACTGACTTCTTCTGATGAGTACGTAGAATATGAGCATAAATCTGTGCAAGATGAT
TCAACTTCGAGAAGTGAGCAGCAGGTGGCAAAGTGCTCATCCGGTGTCTGTTATTTAGAT
ATTATTGAAATTAAAATTTCCAGGAACTTTTTTCATAAGTTAACTTTTCCATGATTATTA
GGTAGACACGTAAAGGTCACGTGGAGTCAGAAAGTCCCATTTCGCTTTGATCTTCAAGAA
ATGCGGGAGAAGAGACGCAGACTTTTCAACCGATTTTGCATGGTTAAGTGTGTGCTGACG
TCACATTTTTCTGGGAGAAAAAATCCCGCATGTTTTGTAGATCAAACCGCAATGAGACAG
CCTGACACCACGTGAAAGGTGAGAATCCTCGCCGTTTGTTACGCGTATTGGTCTCGCCAC
GAGGAAAACGAATTACTGTAACTCCTTTCAATCGATTGACTAATTTTTTTAAGTAAATTT
TTACAATAAATAAGTTTCTCCTAAACAAAATTGTGCAATATCGTTCAATAAATCGAGCCG
AGCTACAGTAACTCGTTGTCCGCGTGTCGAGACCTATGCGCGTAAGATATGGAGGTTTCT
AATCTTCAGACGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1115, 1257..1379, 1447..1767, 1812..1944, 2271..2746, 2938..3213
1107..1115, 1257..1379, 1447..1767, 1812..1944, 2271..2746, 2938..3069
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved