Caenorhabditis_elegans Locus D1054.3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans D1054.3
Caenorhabditis_elegans
D1054.3
V
D1054.17
1675..1780
3382
TTTATTTTTATAGCCCATCGGGAAAATTGATGCAAATCGAATATGCATTGAATGCTGTC
AAGAATGGGCAACCATCGGTTGGACTGAGAGGTATTCAAGTTTTTGTCTTGTACTGTCGT
TTTCAATGGGAAATTCATTTTCAGCTAAAGACGGAGTCGTTCTTGCGACCGAGAATGTCG
GATCTGTTCTCACCGATGACCAGCCAAAGGTAGAACAAATCAGCAAGCATATTGGATGCG
TCTACAGTGGAATGGGACCAGACTTCCGTATTTTGGTGAAGAAAGCTCGCAAGATTGCTA
TGGAATACGAAATGATGTACGGCGAGGAAATGCCAACCATTCAACTTGTCACTGACATCG
CGGCCGTAATGCAGGAATATACTCAATCTGGGTGAGTTAGAACTTTTCTAAACGCACTCT
ATTCAGATTTTTCAGTGGTGTTCGTCCGTTTGGAGCATCGCTTCTTATCGCAGGTTGGGA
CAAAAATCCAGGACGGCCATTGCTCTTCCAATGTGATCCATCTGGAGCTTACTTCGCATG
GAAAGCAACAGCACTCGGGAAAAACGACGTCAATGCGAAAACATTCCTCGAGAAGCGCTT
CAGCGAGGCCCTCGAGCTCGATGATGGAATTCACACTGCTCTTCTGACACTGAGAGAATC
GTTCGATGTTGGCATGAACGAGAACAACGTTGAGGTGGCTGTTTGTAACTCGACCGGATT
CCATCGGCTCACCAAGCAACAAGTCCATGATCACCTTGGAACTCTTTAAATCGAGTGATT
TCACAATTTTCTTTCTTTCTTTTCTCTAATTTATTCTATGTATTCTCCCATCTATCCGTA
CCCGGTAGTAATCTCTTTTTGCTACGGTGTTTTGTTGGAACAATGAATCCTTTTACCGTT
TTACACCCGACTTTTGAGGTACTTTTATTAAGGTGTATAACCCTATTAGGTTGTTTATCT
TGACTGAATTTTCTCAGACTTATGAACAAACTTGTTTTCAGCTATTAATCAAAATGTCTT
CAAAACCAAGGTGAGCATTAAAATTTACAGGATAGTGAATTTTAAAAATTTTGAAATAAG
AATTCGTTACATTCAAATTTCAGGCATGATTGGTTCCAGAGTGAAACTGATGTCACTTTA
ACTATCCTAAAACGCGGAGTGCCTCTCGATGATTGCTCTGTTTCTCTATCAGATAACAAC
ACACTGACGGTCAAGCAATGTGATGAGATTCTCTTCTATGGACAATTATCTGGTCAAGTG
AAAAAAGATGATCTTACTGTAAAATGCACTGCCGCCAAGGTTAGTTGGGTTGAAATATTA
TTGTAGATCCATTAGAAACTAGAAAACTAGATAAATGTCTAAACGTCAAGATTTTCTAGT
GATCCTCCCAAGCATACCTTATTTATTAAATTATGGTTATTAACATTAAAAACATGTTTT
CCGGCCATGGAAAATTGATTGGAATTTGTTTAATTTTAGTGTAGTTTATTTTAACTCGAT
TGAAACAGTTATTCAAGAATAGTCTGAGAAATTGCGTCTAGTCAGAAAATGCTAGCTATT
AATGCTATTAATGCTCTACATTCACCTGAACGAGTTATAGATTGTACCAAGTAAGGACAT
GTGGCTCAGTGGTAGAATATACCCTTACTACGCATACAGTTGTGGTTCGGTAACGACAGG
ATGATGAGTCACTCGCTGAGTGACAATAAGCCGAGTGTTAGCGGTTTTTATGTAATCGTG
ATGATCATTCCCTCAAAAGCGATAATTGTGAACTGACTGTCCGAAACCACAAAAAAAAAT
AAAAAATTGCGTTCCATAATAACTTGATTGGATTTAAAAACGTCCAGAGCAAAATTTTTG
AATAAAACAACTTTTATTTAAAACTTATTCCAGGTAGAAGTTCGACTTCCGAAATTCGCT
CGCAATGAACGATGGGCTTCTCTGCTGAAAGACGGACAAGGTGTTGCCGCTTCTGTACAG
AGTGTATCACCAAATCCAGAAAGTGCACCAACTACTACTGTGAAAAAGAATTGGGATGCT
ATCGAGAAACAAGCTGTAAAAGAAGAGGAAGATGAATCGCTGGAAGGTGATGCCGCTGTA
AACAAAATGTTCCGTAAGATGTACAACGACGCTTCGGATGATGTCCGACGTGCCATGATG
AAGAGCTATTCGTAAATCGTTATTGCCTGAAAACCAAGAGATTATAGTGATTATTTTCAG
TGAATCAAATGGAACCGTCTTGTCTACAAATTGGTCTGAAATTGGTCAAAAGAAAACGGA
ATGTCAGCCACCAGCATGTATGGAATATAAGGAATATGAAAAGTGATGATTAAATTCTTA
TTTTGTTATATGAACACCGCCAAAAATGAAACTTCATGTCAAATGTTTTGTTTTAAAGTT
TAATTAAAATCTCATATCCTCGATATCCCCTTCAGATTCGTTGGTCCCCTGACGCTTGAT
AACTGCTTTGTCTCTGGAGGTGTATAATTTTTCATAACCATTATGTGGTTCCGGATCTGT
TGGATCTGTGGATTGTGAGCTCGTATCTGATTCAAATGGAAGAAAAGCTTGTGATAGTGA
TGGACGTTTCTTATTTGTCATTTCCAATCTGATGGTATTCATTGTCTCGGTCTTGGCGAC
CTTTCCAGCTATTTGTTCGATCCATTTCTCCGTTTCGTTTTTCTGCTGGCTCCACTGTTG
TTTTACTTGATCCTGAAACGTTATATTACTCAATTGAAGATAATAGCTCTGATCACCTGA
ATATAGGATTCAATGTCTTCTGCATGCCTCCTCATCTCTTCAAGAGACATATCTTTCAAA
TCCGGATCTTCAACAGAAACAGTTTGCACTTCAGTGTAATCTAGCTGAAAAGAGCATTCT
GGATGGACAATCGTGTTGTGGCATCGCGTGAAGCTCAATGGTGCTGGTGGAGCACGATTT
GGCGGTGGAGGTGGTGTACGATCATCGCCCAAACGAATCTCGACATTGCATTGTGCACTA
GATGAACCCGGAAATTGATTCGATGACGGTGAGAACGATATCGTGTCATATTTATGACTT
CCCTGTGGTCGGAGAGCAGATTCAGAACGATTACGACCATTTGCGGAGAGAATCGGAGGC
GAAAAAAGTTGTTCCACACTTGTAGACTGTAAACAGGAAGGAATGTTATTTATTATTTTG
TTGTGGACTTAAGTGTACTTTAAAAACATTACAATATTCGGTATGGAACGTAAATATTCT
GTAAAATACAAAACTGTTCAAATTTACAATTCTTCTAATTTCGTACTAACAAATTTGATA
ATACATTTGAGAAGTGTCACGTCACACTGTAAAAAGGTTACTGTGGCTTGCGTCGATTTA
TGGTATTGCATCATCCTTTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1103..1298, 1893..2170, 2220..2382
1013..1029, 1103..1298, 1893..2170, 2220..2322
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved