Caenorhabditis_elegans Locus K07C5.4
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K07C5.4
Caenorhabditis_elegans
K07C5.4
V
K07C5.11, K07C5.12, K07C5.10
1143..1269, 2117..2246, 2626..2761
4508
GAAGAAATGCGTAAAGCTATGAAGAAGGCGAAACGGGAAAAGGCCGAAGGAATGAAAGC
TGCAAGAGAGGTAAGATTACCAATACTAATTTTATCCGGGTCGCTTAGTACTATTATATT
CCTTGAAAATTCAAAATATAAAATACTTTGTTCAGGGTGATCGCGGCCGTAAATACAACA
CTGACTACTCCAACACTGCACCGAACGAAAAAGAAATGGAGGCTTATCGTGTGACAAGTG
TTCATTCTGCTGATCCGATGGCAGCCTACATGAATTCCAAATTTGAGAAGAAACACACCA
AGTAATTATTTGAAGTCGTCTCCGTAGTTTTTTCTCTTTATTGTTGTTTGTTGAAACATT
TGTATTCAGTCTATTCAATAAATTATTCAATTCATGATCACCATTATTTTTTTAATTCCG
ATTTTACAAAATGCCCTTATTCAATAATTCATTTTCGAACGTCTGCGCCCAACTTCGTGT
TAAATAATTTTTAAATACGTGCTTCAGTATATTCGTTCATTCAAAAACCTCCACGTCATG
TTTTCTTGATCTGGATTTATTTACATTCTGAAAATAAATTCTAAGCACATCGATTCTGGT
GAACGGCTAGAAAAATTTCGATTTTTCCCGATAATATTTCGTTCGTCTTTTTTCATTTCT
ATAGAAATTTCTAATAAAACGTTTTACTGGCGTAATTTTCTCCACTGCCATTATTTTGTC
CGAGTGGAGTTCACGAGTAGTAAAGGCACACACTCTTTTGCGAATAGGTCTCGCAGCGAA
AGAGGTACGCCGTCGTCTTTTTGATTCGTCCTTATTTTTTCTCCGGCCTATTTTTGATAC
TTATCGATCCAATTTCGGTTTTTATTTATTTATTTATTACTGGAATGATAAGGAAAGATG
TATTTATAAACAATTACATTAATGTTCTATCAATTCTTCTTTACTTAAAGTCTCACAGTT
TTTGCACCCTTTTTGGTTTTCTTGAATAAATGATTTTTCAGGTTCTTACACCATGTCGGA
AGTTCCCCACTTCGTGCTCTATGAGCATGCAGCTGGATACGCTCTCATGAAGATTAAGGA
GTTTGATGATGCTGGTCTTATCCTCCAAGAGGTACGTTCGCTCGAAAAAAGTATTTTTAA
AATATCCTCGCTTATAAGCCGGGGGACTAGCCTTTGCTGAGTTCACTAGTAAAACGCGAG
GAAAATTATAGAGACATCCAGACACCGATTATGTTGTGATATATTCGGTCACTTCGTATG
TCCCACAGTTTAGTGCTTAAATTAACGCATTTTCAGGTCGATGCCGCTCATGCTGATGGA
TACAAGTTCTCGCAAATCGTTGAGCTTGCTTCGTTTGATCCGTTCAAAAACACCGAAGCT
GCATTGGAAAACTGCAACTCCATCTCTGAAGGTAACAAAGACCGATAAGTTTTGATGGGG
AGTAATTATTTTAATTATTAGGTCTCGCCCACCCTGATCTCACTAATTTTCTTCAAAAGT
CGCTTCCAAAAAAGAAAAAACACGTTGTGCTTGGAATCAATGACTCGAAGCTTGCGGGTT
CGCTTACTGAAGCGTTCCCAGATCTGAAGCTTGTCTTCGGAGGTGTTATCACCGAGGTAA
CGTGAAGATTCACAATAAACTCTTTGGAGTTTACCTGAATCTGTTACCGATGACGAAAAC
ACATATTTTGAGTTTAGATTCTGCGTGGTACTCGTGTTCATTTCGAGCGTTTGGCCAAAA
ATCTCCCACATCACTCCTTATCGAAAGCTCAGCTTTCTCTCGGTCATAGTTACTCTCGTT
CGAAGGTGCGTACCTCGATCGCGCTTTTTTCTCTAAATGTTTTTTGATAGGTCAAATTCG
ATGTGCATCGTGTGGACAACATGGTTATTCAATCGATTGCCCTTCTCGATCAGTTGGACA
AGGATATCAATCTTTTTGGAATGAGAATCCGTGAATGGTACTCTTACCATTATCCAGAGC
TCTTCCGTCTGGCTCCAGATCAATACAAGTACTCTCGCCTTGCTGTCGCTATCTTGGACA
GAAACAAGATGGCTGAAAATGAGAACCTCGAGAATGAGATTCTTGGTAAGTATTATAGTT
CAAAATGTAGATTTTGGGTAACCTCTCTTATAAGCCGGGGGACTAGCATTTTGTTAAGTT
CACTAGTAAAATGAGAGGTAAAGCATAGAGACAACCAGACACCGAGAATGTTTTGATGTT
TTCGGTCACTTTGTGTGTCCCACAAATATTCTTTCCTTTTTCAGAAATTCTTGACAATGA
TTCCGAGAAAACCGCTCAGATCATCGAAGCGGCCAGAACATCAATGGGAATGGATATTTC
CGATCTCGATCTTGAGAACATCAAGAGATTCGCCGCTCGTGTCTCTTCTCTCATGGAGTA
TAGACAACAACTTCACGAGTACATTAAAGATCGTATGGACCACTGTGCTCCTTCTCTCAG
TGCTCTTATCGGAGAACAAGTTGGTGCTCGCTTGATCTCGCATGCTGGTTCGCTGACCAA
CTTGGCCAAGTATCCAGCGTCCACTGTCCAAATCCTCGGAGCAGAGAAGGCTCTTTTCCG
TGCCTTGAAGACCAGATGTAAGTCATGAAAAATGTATCATTAATTGATGGCATGTATTTA
ATGCGGGTGGATGATTTTAGTTCAGCCGTTTAGCTTGCATGCAAAATTATTTTCTATTGA
AGATTTTATTCGCTGCACTCGGTCATATTCGAGTCTATGATTTTTCTGAAATTGGTACAT
TTTCAGCCAACACTCCAAAGTATGGACTTCTCTTCCACTCCAGCTTCATTGGAAAAGCTG
GAACCAAGAACAAGGGTCGTGTGTCCAGATATCTTGCTAACAAGTGCTCCATTGCTGCTC
GTGTGGATTGCTTCTCCGAGACTCCAGTTTCGACATATGGAGAATTCCTTCGCCAACAGG
TTGAGGATAGACTTGAGTATTTCACCTCCGGAACTGTTCCAAAGAAAAACATTGACGTCA
TGAAGGAGGCCGAGGAAGCTGCCGTTGAGGTTAAGGAGAAGGTACAGTTTTGCGCAAATT
TCCTATTTAGCATGTATTTAATGCGGGCAAATTGTTTTAATTCGGCCGTTTAGCTTGCAT
GCGATATAATTATCCATTGAAGAATTTTTAGCTGGGTTTCTCTCATTTTAAACTCATGAT
CTATCTTTTAAGGAAACAATCAATTAAAAATTGTATTTCAGGTCATCAAAAAGAAGAAGA
AGGCTGCCAAGAAAGCCAAGCGTCTTGCTGAAGAGTCTGTCACTGCAACTGCTGAAGCTG
AGGTTGACGAGGATGCTCCAAAGCCAAAGAAGAAGAAGAAGAGCAAGGCTGGAGACGAGT
AATCTTCATCATCACTACACCACTGATCTTTTTTGTTTTATGAATGTAACTCCCCCATGT
TGAACTATTTTGTTTTTGTTGACTGTTGGACCCCTACATCTTGTTGTTACTCTGTTTTCT
TCTTAATGAATAAACTTGTATAATCCAGCGTAAATGTTTTAGAATTGACTTCACATATAA
ACTTCAGTGCGAGTAATGTTCGAAAGTGCTCTGTTCACTACACTACGCGAAGCCGTGTAT
TAAGAATGAGAGGGCGGCGTCAAAATCTCGAGAAGGGCGGGGCCAAGAGAGCAAGACTGG
AGCTTAGAAAATGCACAACACGTCAGTTGAGACTCAGTCAGTCTCATAATAGGTCGGGAA
AACAACCCTTTTCGTTCTTTTAGAGAGTAAATAATAATTTCATTAGTCGCCTTTATTGAT
ACTGTCTTATTTTCAGATCTGTTTTCAAAATAATTATTAATTTCCAGTATTCTCTTTCTT
TGGTCTTCCTACACAAAATGAATTGCCGGCTTTTTGTCATTTTCGTCTCAATTCTCGTTA
CGGTTTTTGCACAGGTACAGGTTTTATTCATTAAAAAAAGAATGGAGAAGAACTTTAATT
ATAAAAAGCTAAACTTATTTTAACTTTGTTTTTGCAAAAAAGCTCAGAATATAGTACTAC
TTTTGAAGAAAAAATCTCTAGAAGCCAAAAGTTTTTGATTGGAAGCGTTATTTTTTGGTA
ACTCTTGCCATTTGTGCAATTTGGAATGTAGAAATTCATATGCTTCAGTCTTGAATGGAA
AACTTGATAAACTTTCGGTAGATAAAAAATTATGGAGATCGTGTCGAGAACCACCGAAAG
AATGCACGTGTACCTTTAAAATGATGAAATCCTTACGAAACTATTTACGACAATTATTTA
GAGAAAGAAAAATATTAAGAAGAATCAAAATAATTTGTCATTTTTAATTATTAATACTAC
CAGCCGTGGACCGCACCTCCGGCGCGGCCCCCGACTTCTGGGGCTGAAATCTTATTTTTC
TGAAACTACCGTAACCCTACAGTATTCCTACCTTACCACTATTGTACCACTACAGTACCC
CGACTATATCCCTACACTAACCCCAACTCACTATCCCCACAGAAGCCAAAACTTCACAGA
CTACAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1110, 1296..1410, 1461..1615, 1697..1804, 1850..2084, 2264..2596, 2766..3040, 3221..3508
1012..1110, 1296..1410, 1461..1615, 1697..1804, 1850..2084, 2264..2596, 2766..3040, 3221..3358
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved