Caenorhabditis_elegans Locus unc-41
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans unc-41
Caenorhabditis_elegans
unc-41
V
C27H6.5
6848..6915
11715
CTTTTTTAGGCATGACTCTTCGTATTTTATATGCATAGAAAGCCTAGGAGTAATAGCGG
AAAAGGAGAGACAGGGCAGATTGATGGGTAGATTTCATGGGTTAGGCACCTTTTTGAAGA
TGGAAGAAACGAATGGAATGGATAATCTGAAAATCAATATATTCTTAGATTCAGTATTTC
GTGTTTCGGCTGAAACCCAAACTACCGGTCCAAATATCCAAAATATCAAGTTTCCACTTG
TTGACACACAAATTTTTCGTTTCTTCCGTTTCTTCTTGTCTTTTGCAAAACCTTTTTTGA
CTAAATGACGTAGTATATTGCCAAAATCTAAGTGAAAAAATAACCTTTCATAGTCTGTTT
TGAAACAAAACTAAAATTGAGCCAATAGATTCAATGCCTAATCAATTTTTAATGAGGTGC
ATAGTGCAAGAAAAATAATAATATATGTATATACAGAAACAACCAATTTTTCTCTTATCT
CAACTAAAAAAGTAGATAAATCTTTCTTTTATTTCAATATCTATACAAATATACCATACT
TCCAATCTTGTTGCTAAAATTTGTTTTGCACTTATTAAGCCGAACAGTGTCTGACGAATC
TTGTTTTATGACTCTCTAGTTAATGAATGTTTTGTGCATGTTTTGTCAAAAAACCCACAG
GTACCATTAGATCACTTAAGGGAATACAAAAATGCCTTCAGTAATTTAATTCTATCAATT
TTTTGAAATCCCTAACTTATCGAGAAAACTTGAAAATTTTTTTTTAACATAAGACATGGT
CCCATACCGTTCCTGATTTTTCCCAAATTTTAAATAACCTAGACAGGCTCCAATTCTTTC
ATTTCTTGTCTATTTATTCATTAATCACAATGTCCCTATATTTTTAAGATTAGATGTCTT
GGAGAGACCGTGATTTTGATCCACACGGTGGCCGAAATGCTTTCCGATTAACTGATGAAT
CGAAACAGTCATCTTCAGAACGAGCAGCTTCAATGAGAGCAATGCGTTCATTTACTCAAT
CAATTGAAGATGAAGGTCCACCAGAATTACCAGCTTCACTTGACATCGATATGATTGAAG
GAGTCAGTATGAAAACATCTGATACAAATGACACAATCATTGAAGTTAAGCCTGGAAAGG
TGGATCCTCAACTTGGAGAGACCCAGAAATATAAAATGGCAGTACCTGGTCCCGGGCACT
CTGAACAAGAACAAGAACTTCACAAAAGTTTGATAAGGGACGAAGAAGAAGATGCAGAAG
TTGAACAAGTATTTGCAGCATCTGCAGAACCAGTTGTGACACCTCCAAAAAGTTTGAACT
TCGCTGAAACAGCTGAAGAACTTCGGCACGCGTATGATCAGAAAATTCGAAAAAGGCCTA
CAACTCCAACATCTGCGTGTGTTTTAGATGGAATCGCATTCTTTGCTGGAAGTGTTGATG
GTTCTAATGATACAATTCCAACAGATGCAGAGAAAAAGATTAAAGTGTCGATTCCAAGTG
GTCGAAGGAGAAAAACAGAGAATATGTCATATTCAGAATTTTACGAGTCGATGGCAAATC
AGATACCCGGAGGTGGTGGTCGAAGGATGAGTCAATCTGGAAGAACAACTCCCCTTCATG
ACTATGAAGGAGATATTCTTGATGAAAATCCACAATACAAGGATAAAGTAAGTAATTAAT
TATTATTTTAAAAAACCGAATACAAAAAGAGTCTAGAGCAGATATGGACGGCAATTAGAA
TTTTCGACAATCCAGCAATTCTTCAATCGCCAAAAATTCCATTGCCGCCCAAACATGGCA
CAATTATTAAAAACTGCTTAAATTTGATTGTAAATTTTTTCGAAACTTGAAAAAGCTATT
TATAAGTTTTTCAAAATTTAAAATTAGCCAATTCTGCTTCATGAATTGTCTGCTGTGCTC
ATTTTTCGGACACAGCTTATCAAGTTTATAAATATTTTGACATCAAATTCTTACTATCGT
TCACATCTGAAAAGTTAAAAATGTCAAAATTATTTCCAAATCAAAAAATACTTGTTTATT
CAGGCTCCTCCTGCTCCGGTTGTTCATCGAAGGTCAAGTATCGAATGGGAAAATTTCGCC
GACATGGAAGGTACGTATAAATTTACTGCACAAAAAAATCCCGAAATGTATGAATATCGT
CAGAATACATAGTTAAACGAACCGAAAAGAAAAAAGATTGTCAGAAAGAATCGTAATGGG
AAAAAAGATGGGGAGCGGATATTGAGAAATGACGTTGAGATATTAAGAATTGAATGGAGC
AATAGCTGAAGGGTGGAGCAAAATGGGACAACTAGACAAACATATCTAGATTCCGTAATT
GTCTGTCACCATGCTTTGGAACCCTCAATTAGACATCACTTTCTCATTCAAATATCCTCA
ACGACTTCATCTCAACTTCTGCTGCAGCTCCCTGTTCCTTCAACGAAAAATACTTGCTCC
CATTTGCTAATCCCCTGTCCTCCCTTGTCTTTCACCCTGCTTTGCATATTTTCTCCTTCA
CTTCCCATGCTCTCTCACGTCGTCAGAAGCACGTAAAAACTGAATTGATCATAGAAGGGG
TCGAGCAAAGAGAGAAAAGGGAAGAGGAGTGCGGAACTCTTCACTTCTTTTCTCTCCGCT
TCTTCATTTTTCACACTTTCTTTACCTCATCTGAAACGGAAGATGTGCCACTTCTACTGC
TGAGCCTGCGTCGAGAGAAGGGGAAGCCATCGGTGAATTGAAACAGCAGCGATTTGGGAG
AAAGAGTTGAGAGAGAGAGTTGGAACCAGTTTTCATTGTCCTCTTTTATTTTTACTTTTT
CATATTTTCTACTACTGCTTTAAGTTTATTTAATTTGAAATCTAGATATCTGCAACAGAG
CGTACACATGGAAAAACTTTCTCCAGCACTGGAGCAGGTAGTTTGATAGAACATTTTATT
TCAGCTGTTCCATTGTGTAGAATTCAAAATTTATTTTACTTGCAACTGGTTTCTGTTCAA
AAAAAAATCAGTGTTAAGCCATATTATTTGAAACGGCCACAGTCTTTCCAATACTTTTTG
TAGGGTCAACTGTAATGGTTAAAGATTAAAAAAAACAAATTACAACCTTTTCAAGTTGTT
ACAAAAATATTATCCACAAATAGCAGTTTTAATGCCATTTATATACAAGTTAAACTTACC
GTAGTTTCTCTATTAGTCTTGCACCTCTACGGACCAATCGAAAATTAGTCTTACAGCCTC
TATTAGTATTGCACTCTATAATAGTCTTGCACTCTTTTTTTTCTAGATCAGCAATTTTTT
TGTAACTTCAAAAAATTCGTCATTGTTTGGCTGAATTAAACTTAAAAGAGTTCAAACAAT
TGATAAAATAATGGGCAAGTATTTACTTTGCATGGTTTAGACTGTTTCTAGTCAAGTTTT
TTGACGAGAAATTGCAAATTTTACAGAGCTTTTGGATCTTCGAAAATTAGTCTTGCAGCC
TCTATTAGTCTCGCACCTCTAGGGATCGATTGAAAACTAGTCTTGCATGCAAGACTAATA
GAGGAAATACGGTATAAGTATAATAACTACTTTTCAAAATATGATTCTGTGAAAATTTAT
TAATGTGTTCACTATTCCCCCTATTAACGAAGCACCTGCCTATTCTATTTCGTAAAGCTC
ATCTCTTGGTTAATTTTAATTATTTCGGATACTTTTCAACTGAAAAAATGTAAATATTTT
GTCTATTGATAATTTTTTTGATAAACCCAAAGACAAAATCAACAATCTTGATTTTTCAAA
ATTTTTATAGATGAGAAGCAGATTTTTCCAAAATATAAAAGGTATATCTATTTTTGTTTT
ACTGCTCCCTCAAAAAATACTCTAAATATCAAGAAGACAAATCGTGCTCATTACAAATCA
AGACTCCCTCTGTCTCCTTCCCCTCTTGCCAAAAATAATTATCATGCTCATTGAGCAGAA
CCCTCTGTCCTCAACGACTCATTTTTCCTTTCTATTTTCGATATTGTAGTATTTACATGA
CATAAGAAATCTTTGATGTGTATTGACTTCTGAAACTCAAATAATTTTGTATCTTGTATC
TATTTAGCCGCTTAAATGATGTCATCATTTGTAACCTGGTGACGGGAAGTAGAGGAAGCG
TGGGCCCCGTAATTTGTGCATCAAGTGCACCACCGTTTGCCCTCTCGGCTCACACATTAT
TCACGTTTTCGCTTCCTATAGCTTTTTTTTAAATGCGATTTTTTCGCACTTTCAGAGATA
GATTCAATAATTTGATCTGTTGATGCGGATAGTTTGACCTAGACCCCTCTTCATTATTAA
AATCAAAAATGTTCTACTTATTTCATTAGTATACTATTTATCTTTTTTTCCTTCCAGACA
AAATGGAACAAGCAGAAGAAAAAGCAAGAAAGGAAGAGAAAAAAGAAAAAGAGGAAACCG
CGGAAGTTGCGCAGAACGATGATGTCACTACAGAAAAACATCAGAACGAAGTAGAAAAGT
CGAAGAAGATGTTGAATTTCCTCGCGAAAGTAAGAATATAATGGGTTTTAAAGGGATTAT
ATATGATACGTAGGTCGAATTTCAGTAGAAAATTGCAATTTGAAAAATAGTTACGCCAAA
GGAAAACATGTGGAAATATAAAAGTTAAAAAATTTTGACATTTGTTACAAGTTAAGAACA
AAACTTAACAAATCACCTTCAAATTTGTAAAATTTCAAAAAATCTGAACGTTCAGTAATT
GCAACTTTTGTGATCTATCTTTTTGTAAAGTTTTCACATTTCAAAAATTGTTTTGAATAG
TTTTAATATGTTCTTGTTCATGTCGGCCATAGGAGTGTTTTAAACAATGTCCCCACCGGC
ACCACTCCACCTTTGTTCTTTTATTATTCGATCCCAACACCTTCAACAACTTTTATTTTC
CATTTAGTTGAATTGTTCTTCCTTTTATGCGAACTATTCTTTCGATATAAAATATTCTGA
TTAAATTAAAACAATTTTCAGCCTCCAACAGTGGAAATAACATCACCAGATGCACCACAC
CAAGGGGTAAGTAAGCTCATTTCTTTCGTTTCGGTTGTCACTATTCCTCGTCTTACGAAA
TCCGAGCCGATCGGATTACCACCCTTTCACGCCTTCCAATTTCTTTCATCTGGTTTTTTC
TAGGCTTTTCACGACAACACTCCAAAAGAACCTAAAGTTGTTGAAGAAGAAGAGGACGAC
GATCTGCCAACATTCTCAGAAGATATGGATGAAGCAAGGCAGCAAGTGATGAAAGAAATG
ACTGAATCTGTTGTGAAGACTGAAAATGTGGAGAACGAGAAGCAAGAAGACACCCATATA
TCAGAAGGACACGTGGAATACGGTACAGAAGAATCACCTGCAGTAACTGATGGAAGTTAT
CAACAAGATGGGACTGAAAATGCTTATGATCCAAATGCTTATCCTGGTATGTTTTTTGAG
TATTTTAGTTTCTACTTATTCGAATTAATACAGTATGAGCGTATTCCAATTAACGAAAAT
GAGAGCTCGCTTCTCTTCATCTTTTTTTTAGATAACAGTCGTTTGAAAACAGTAACTAAA
TGCAGTTTCTAAATCCGAAAACATATCCGAAATTTCAGGTTACATCTGGAATTATGAAAC
ACAGGAATGGGAATACGATCCAAGCTATGTTGCTCCAGAAGAGCCTATCGACCAGTCTGC
ATATGAAGCACAAGCAGCAGCTTACGCTGAAGTCGATCAGAGAGCTGCAGAGGTCGTGTA
TCAACGAGAACATGCTGGATATGATCAAGGAGATTTTTACACTCATCAAGATACGAGCTA
TTCTTCAGAAGCATATGCTCACGATCAAGCTAAAGGATATCAAGATCCGAATGCTTATGG
AGCAGAAGCTGCAGCAGACAATTCTCAAGAATACGACTATTCTGCATATGGAGGTTATGA
AGGTTATCTAGCTGCATGCAGAGCATATGATGAAGAAAGTCAGCAACCACAATATGGAGA
AACTGTAGCAACTGAAGCATATTCTCAGGATTATGGTTATGAGCAACAAGGTGATTATCA
TCATGAAGGAGTTGGAGCAACTGACGAAAATTCAACATCAGCAATATCAGGTTATGAACA
AAATGGTGCAAGTACTTCCTTAGGATATGGTGATGCTCAAGGATACGATGGGTATGATCA
CAATGCGTCATACTATCAAGGCCAGGAATATCAACAAGAATATTATCAAAACCACAAGTA
TGAAAATTCTCAATATCAAGTTGATCAGCATCCAGCCGAATCAGCTGCTCCACCTCGACC
TGTTGCTCCAATGGAACCACTTTTCAAACAAGCTCCTCCACAGCCAGATCCATTCGGATG
GGATTCATCCGGTCACACAGGTGATGCTCCAACAGCTTCGGAACCGGTTCAAGAGTTATC
TCCAACACCAGAAGCTTCATCATCTACTGGAACATCTGCTCCAGCAAGACCACCACCGGC
AAGACCAGAAGCTCCAAAAAAGGACGAGACTGCTGTTGACGCAGCCGGTTAGAAATTCTC
AGAGTACATAATTATAATACAATTCTTTGATTTTTAGCACCTCCGAGACCTCCCCCAGCA
GCCCGTCCACCACCACCACGACCAGCACCAGCTAATAAAGAAAAACCGAAAGAGCCAGAG
CCAGAAGAAGATGCATGGGCGCAGTTCAAACGAATGACGGAGAAGGTTTGTAGACACAAA
GGGGATCCCTCTCTCTCTTTTATATACGCGTAGTTTTTCAACCCAGCGTTGTCTCTGTGT
GGTGCAGTGGGGAAGAGGCGCGCGCGTCGTTCTTGGCATCGCTAGCTCGACCCTCGCGCG
CTGCTATTTGGGCGGTGAAATTGTTGCACAGACCTGTTCCTATTAGTTCACTGAGGAAAA
TAGCAATCATGAGCCTTTTTGAAAATTTTTATTTTTTTAATTTTTCAGGTCAGCACTGCA
GTAAAATCAACAGAGAGTACTCTGAAAAACTTGGAGGAGACATCTGCAGCGAATGACATA
AAGGATGAAAGCTATCTAGCAAATGTGGGAGGCTCACAAGGATTTGTTAATGAATCGACA
CAAAAAGAGATTCAAAGGTTGACAGAAGAGAAGAAAATGGAGAAACTTCAGAAGAAAAAG
CTAAAGCAGCAAGGAAAGAAAGCTGCAACCCCGACATTGGAACCTGATGAAGAAGACGCA
ATGGATCGGGCTGCACAAGAGTTAGCGATGAAAATGGCAAGCATGAGAAGCGATATGGCT
GATTGGAAAGCCCCAGAAATGATTCCAGTTAAAGAAATAAAAAAGGCCCCAGAGATCAGA
AGAGTAGATTCAGCATCTGCGATTCCCCCAAGAAAGAGAAGTTCAATAAAAGATGTTCAA
CAAGATTCTGGAGGTTCCCTTGAGCTTCCACCTCACCTAGCGGCTCCTCAAGATTCAATT
GCCCCAAATCCAAAAGGAGATCATGCTCCAGATGATCCAATACTTTCTGCACCTGCATGG
GCTGATTTTGAAACCTCTGAGCCAATGCTTCCACCAAGTGAATCTGGATTCTTCTCGAAT
AAAGATGCTTCAAATGAAGGTGGTGTGTCAAGAGATGCTACCGATGATCCATTTGTGACA
ACTGTAGCTAGTTCTGAAAAGAGATCTAGTTTTGTAGCAGATCCTTTTGCACCACAGCAA
GCTGCTCTGATTGATGAGGTACGTTATAATGGGAAGTAATAAACATTACATATATCCAGC
AAAAATAATAAACTGGCCCTATGTAAAAAATTAAGTAACTAAATTAAATTTAACTTCCGA
CTGCTTTGACACATACATGTTGGCAAAATGGGAGATTTTAACTTAGAATACTTGATGAAT
AATTTTCAGAGTTACGATCCATTTGCTGTGGTTGCAGTGGAAGAAGTCGTCGCAATGGCA
AAAGCAAAAGCCGAACAAGCTGCTGCTAATGCTGAAAATGAAGATGATTTCTACAATGGA
CGACAATCTCCAACACTGTCAACACCAACTCCAGAGGGTGGCAGCCCAATTAGCCAGCAA
CGCCCAAATGCGTTTGAAGATGATTTCAAATGTGCAGAACTCACTGGCCTTGATACACCG
ACTCCGTTATATGATGAAGATGATTCTCAACCTCTCACAGACTTTATTCCGAAATTTGAT
GGAGATGGTTGGGATCTTATGGTAAGACATCCTATCAAAAAGAAGTCATTTATGGCTGAA
AGATGTTGGAAACCTTGTTATGTTCGACTCCATGGACTGACACTGTATTTATACAATGAC
AAAAAAGATGCTCAACCAATTCAAGAACTTCTTCTTCAAGCAACGTATTCGTTGTCAGAT
ACAACGCTTCAAGCATATGATGTTTATGGAAAGATTCACACTGTGAAATTGCAATTTGTA
GTTTATAAAGAAAAAGTTGGAATTCGTCCAGGACAAATCAGTCGATTAGTTGATGGCCAC
ATCACAAAATATGGTTTACCTCTAGAACATTCTGCTCAATGTACAGTTCTCTTAAAGTTC
GGATCCCTGAATGCGTCTCACCTCCAAACTTTTGTCACGACTGTTGAAGATCTTTTATTT
AAATGCAAAATTACTCGAACTGCAAAACCAGTTTACAAACAAGATGAAGTTCAAATTCAT
TGCTATGATGAATATTCTGCATTTGTAGACAAGGAAGGTATTCTGTCAGATCAGAAAGCC
CGCGTTCGACTCTTTTGTCTTGCATTCCTCACAGGATCACCAGTTCTTGAAGTTGGATTA
AATGATAGAAGACGACAAGGAAAAGAAATTGTTAGAAGGAAAGATATTCTGCCAATGTAT
ACGGAAAGATGGATTCGATTTGAAGCTTTGGAGTTTCATTCAATTGTGAATAAACCAGAG
TTTGATAAGGAACAAGTTATTGCATTCAGTCCACCTGATGGATGCTTCTTTGAGGTACCT
TTAGAAAATTTTCCAACTCTTTCGAATTTAAACTCTCAGCTGTTATAAAATAATAAATCC
AAAAAGTACTGGAAAACGGCAATATGGTTCCCATTATTTTTGTTATTTGATTATCAACCT
CATTTTGTTAAAGTTTCATTTTCTTTACAAAAGTTCTACTTTTGTTTTAAAAAAACTAAA
AAATATTAAAAAAAAAGAAAACTATATTTAGTTACCAGTTACCAGTTATCACATTATTTT
AATATTTTTAGATAATGCGTTTCCGAGTACGTCCACCCCGCAATCGTGAAAAAGCAATGA
CTGTGAAGTCTATCATGAAAATTGCTGGATCGAAAGTCGAAATTAGAATTGAAGCAATGG
CTGCTGCTCAAATTCAACGTACACGTGGATCCGATGAACGTCGTAATATACCATGTGAAG
ATATTGCAATACGATTCCCAATTCCTGAAGCTTGGATTTATTTATTCCGAGAAGAACGTC
ATTGGGGAGTAGGATCAATTCATTCCAAAAAACTTCGACCCGGAAAAGTGAAGAATCTCA
AAGATCGACTTCTAGGAGCAGTTCAAGCAAGTGAACCTAATCTTATTGAATGTGCAATTG
GAGAGGCTAAATATGAACATGTATATCGTTCACTTGTATGGAGGATTCCAAGACTTCCAG
AAAAACATCATGCAGCTTACAAATCTCATTTACTAAAATGCCGATTTGAACTGTCATCGT
TCGATTTAATGCCAGAAGAGTTTCTTCCAAGATGTGATGTTGATTTCACAATGCCTCTGG
CAACTGTCTCGAACACTGTAGTAAGATCAGTATCAGTTGAACAACATGAAGATAGTGATC
GCGTGGAAAAGTTTGTCAGATATGTTGCTAAATATCAGTATAAGGTATGTTTTTTTTGTA
GGAAAGTTATTTCATAAAGGGATTGTTTATGAAACATTAAAAAAAGCTACTTTACGAACC
ATATAGTTGTTCCACCTATTCAGAATTTTTAGTACCCATCTAAAAATAGCTAAATCAATT
CTTTCGAAGAAAAAAATTGTTAAAATGTGTGATTTTCAAATGTTTTTCAAAAAAACTCAC
TAATGTCGAAATTACATTTTAAAAAGTCGTTGAAGTTCTAATTTACAAGAGATTGAATTA
CATTTCAATAAAATATTTAAAAAAGTTTTTTTTCCAGGTTGAAATCGACTACGTGCAATG
TGCCGATCTTGATCTCGACATGGCGGATCCATCAGTAAATCCTGAAGCAGCAGCAGCTCC
AGTTCCAGAACTTCATCAACCAACATTTAATCCATCTACCCAAGAGTCTGATACTCAACA
AGGGTATTTCATTTCAATTTATAAATCTTGAAAATCAAACTGTTTTTAGCTACCGAATTG
ATTTCAACGAAGCCGAAATGGGCGGTTCAAATCGTCGCGACGACTCGAGTTCCGATGAAG
AACCTGATAGTCATAAAATGCCAATTATACAAATTGATATGAAGAATTATGGATATTAAT
TTATTAAATCGTTTTGTTGTGCTTCAAATATAGCTTTAAAATTCTAGTAACTTATTAATT
TTCATATTTTATTTTCAAAAGTATTTTAATATTATTTTCAATTTTTCCGATGCTCGTTTC
ACTTCAAAATCTCACCCCAAATAGCTTCACATTGTGATCTCTTTCATTTGTTTTTTTGCA
ATAATTGATGAATTAATAATAATAATAATTATACAAGTCAGTAGATATGGTTTGAAAGTT
TAGAAATTAGACGCAACACTTTTATAATGCTATAATAAAGTATTGAATTTATGAAATATG
TTTTGAAAATTTCGATGCAATTCAGATAACTAAGAGCATGACCTCTAAAATTATACAACT
TGCAAACCTAGCTCAAACTACGTACTTCCATTCATTTCACAAAACCTCATTTTTAGAAGA
GCTGTTTTTGGCCAAGTGAAGCTCTTTGCTAGTGAGCGCGCGCGCATACAACCACGACCC
ACCCGCATGAAAAAACGAAAACGTACACCTCATCGGCTCATTCATGCGTCGTGTACACCG
CCCCGACGATTTCATTTAGAATTGCGTTGCGTACTCGCGCTCGCGCTCACATCGACGTAT
ACGCGAAAACACGACTTCAGGGGGGCAGGCACAGAGGCACAGAGCCCGGAGAAGGAGGAG
AAACACAGCTCAAATATATGTTTGTTAGAAGACAGAGTGGCACCAAAATCAGTCTTAAAG
CTAGAATCTATTGACGCGATGGGAAATGAGGGAAAACATCTGGAGGCTAGAAAAACTTTC
GATCTGATATAAACATTTAGAACATTCGCTGGCGGCTATGACCTAACACTATTTTTAACT
GAATCATTAGGAATGTGCCAAAATGAAAGTAGTTAAGTTTGAAATGCTCAATCAGCATGA
GTAATATTTAAATACCAATTAAAAACAAACATTGTAAATTTTGGAGCACAATATTTTAGA
TATGGTGTTTAGAAAAGAGAAATACCAATCTAATCGTAAAATTGATACTTGACAATTTTC
AGCATCCATCGAGAAAGCTCGGAATACAAATGGAACATTATCTTTTGTAATTTGAAATCG
TTAAGTAACCTCTTGATGACCCTCTAGACATAACTTCAAAAATTTGAAAGTTTGAGCATA
AATTGATAGTCTAACGAGTATTCCTTATGTACATATCGTCTGAGTAGAACAGAAGAAATT
AAATCTCACTACATATATTCCCATATTGTCAGTCATATTTTTCTATTCGCGACGTTCTTT
TTTTGCTGAAAAATGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1666, 2043..2109, 4377..4528, 5001..5045, 5163..5445, 5618..6526, 6577..6704, 6948..7697, 7869..8933, 9191..9823, 10117..10262, 10309..10715
1001..1666, 2043..2109, 4377..4528, 5001..5045, 5163..5445, 5618..6526, 6577..6704, 6948..7697, 7869..8933, 9191..9823, 10117..10262, 10309..10435
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved