Caenorhabditis_elegans Locus pxn-1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans pxn-1
Caenorhabditis_elegans
pxn-1
V
ZK994.7
6685..6751
9266
ATTATTCTGCTATTCGCATTTTGTTTAAAAATGGTCTCACTAGATTTTGACAATAAGTT
TTGCTAATTTTGTTTAATTACTTTTCGGAAATTTACAAAAATTTAGTATGAATTGTTTTT
TGTTACAAATAATCACAGTTGTGCTGTATATCTACTAAACATTTCTGCTCTTGTAATTTA
AAACTAGGACTAGAAAACCAGAGTAAACCGTGACTCCCCTTATTTTTTCGCATTTCCAAT
AAACTCTCAACTGATTTCAAAACCGAATCTAATAGTATTTCTAACATCTGACCGAATTTA
GACGTTCTTCGATAGAGCTTTTTGGAAATTCGGAAGATTGTGTCAAAATGAAATAACGAC
GTAACCTGTTAAAAACCAATAGTCAAGTATCAAAAGTAAATCTCGAGAATCAAATCAATT
AAACGACATGTTCCTCCTCTCTTCTTCTTCCTCGTTCTTTCCATCTAAATTCCATGCTAT
GTTATCCTTTTTCTATCAAATAATCTTGTATTCCAATCTTTCCTCGTTCCATTCTCTCTT
TCATTTATCATTGGTTTCTGTGAAGCTCTTCGATTCTTCCGACTCCCCGCGCATCAATTA
TTCGTTCGGAATGTGTCCTCCAGATGGATTACGAAATGACGAATGAGCCGCTCGTAGTCG
TCTAAGAAGTGAAAGGCAAAGAAGAAGAAGAACTTATTTTACTTATTCTTTCCACTTTGT
CATTTTCATTTTGTTTCGTTCACTATCCTTCATTCTCTGATCGAAACCGCCAAGATATAT
ATGCCCAGCTGTGGTGACCTTTCTTTTTCAAATTCACTTCGTATATATCACTCTCCGTTG
ATTTTGGTTTTTATTTCCGTTGTTAAAAGAACAAGATGTGGATTTTTTAGCTTCTACATC
CTAAAATTTTTTTGAAAATGAAATGACACAGTATCTACGGTCTCTATCAGTTTTAAATAT
TTGAATTTCTCCTGATAACTCCAATTGTTGATTGCAGGTTAATGAACTTATATCTCCTCC
TACTTGTAATTGCCACGTCATCGTGGCAATTTGTGGCTGGATTGGAGTGTCCCGTGGAAT
GTACTTGTGATAAGAAGGGACTTGTAGTGGATTGCAGTAGTTCTGGTAAGCTTTATATAT
TGTCGAATTATGTTGATTACACCATTTATCTTGAATTCTTATTGTATTTAGACACTGTCA
CCGTGACAGTTTTCCTACCGCGATGATTGTGTGTCCGAATTTTAAGTTTAAAGTTTGTTA
TACATAAATTAAGAATTATAGAGTAGGGATTGTTAGATAGATTGATCATAAATATGTACA
TGGAAACCAACAGTACAATCGAAAAACGTACATATTGCATGACAAGTACACCAAAAAACT
GTTTGGTCTTTGAAACCGGGCAGCCGGGGCCTCCTTAGCTCAGTTGGTAGAGCGTGAGAC
TTTTAATCTTAAGGTCAGGGGTTCGAGTCCCCTAGGTGGCTTGATTTTTTGCTCAAAAAT
TGTATAATTTTATGAATGCTTGTTTAATTTGCACTTGAAGCATTTGTTACAGAAGAATAT
ACTGCCTAACCCCAAAATTGCATTACCTATAAAACTGTATTAGTTGAATATTTAATTGTT
TCATTTTTCAGGCCTCACCAGGATTCCAAAAAATATTTCGCGGAATGTTCGTAGTTTGGT
AATTAGGAACAACCGTATTCACAAACTGAAACGATCTGATTTGGAAGGATTTAATCAGCT
TGAAACTCTTGTCCTTACTCATAATAAAATTAAAATAATTGAAGAGGTCAGTTGTTTTTA
ATTGAGATTTAAGATTTTAGTTGGTTACATTTAATTTGGCCGATAGAAATTAAAATCATT
TTCAGAATGTTCTTGATCACCTTCCAGAGCTGAAACGTCTTTCATTAGCTCATAATGAAC
TGGTTTATATTCCACCACTTTGCTCTGATTCTCGGCCACTAGCATCTCTGAATTTGAAAC
GAAACCACATTCAATTTATTGACGAGCAGGTGGGTCATTTGAATCGAAATTGATAAATTA
GACATTTTTTAGGTTCTACGTTATTTCCCAGATCTTACACAACTCGATTTTTCACACAAT
AGAATACAGTCGTTACGTACAAAACTTTTCGATAATCTTCCAGCTCTCTCACATGCACAT
TTACATTCAAATCCTTGGCATTGTGATTGCAGGTATGCAAAAAATTTCGGTGCCTCATGC
TGGAATCGAACCAGCGACCTTCTGTTTACTAGACAGACGCTCTGCCACTGAGCCAATGAG
GCGCGGCAGCAACGGATAGAAAACGTAAGAACGAAACACATGTTTTACAGGGCATCAAAA
GTAAAAGCCTTGTTGCAAAAGGTGAAATGGGAGAAAAAAGTATACTGTACAAATCCCGTT
GAGCTACGTCATCAGGCACTAGATGAGGTCTGTATTAGATAAAAATAAAAATAAGAGTTT
AATATTATGTTTTCCAGGTGGACGATTCTGCACTGACCTGTGCTAGACCAGCAGAAGAGT
CATGGACCGGCGAGGAGATAAAGCTGACATGTGCTAAAAATTCCAGCAGCAAGCTCGTTG
TATGGATGTATGAGTGAGTATAACCTTTGGATCAATAATATTCAAGTTCATATAAAATCA
CTTTCAGAAATGTCGAGGTCGATTCATCTTCACTGGACGGTTATGAGATACATGATACAG
TGATAACTGTTCCTCGAAAAACCAATGTCAACTTTATGACATGTACATATGATTTTGATC
ATATTCCACATCACAGGTAAATTCGGAAGAAAAGGAGTGCGATACTGAAATTTTAAATAT
CATCTAGGCTTTCCTGAAATTCCTTATTTTTCATTATTAAGAACCGTTTTTTTAATAAAA
ATAACTTGATATTCCTTTTTTATTCCAGACGTCTCCGACAAAGCCAGCATCAAGGAAATG
GTTCTCCTCAGTTCACATATAAACCACGGGATAATTCCTTCCGAGAGGGATCAGAAGTTA
AAGTAAACTGTGAAGTTATGGGAAATCCAAAACCTACAATAAATTGGTATCATAATGGAA
AACGGTTCATTTCATCGAGAAAAAGGCAACTTGGTCTATCCAATAATGTTCTTCGTATAT
ATCCTTTCTTGGAAGAGGACTCTGGAAGGTATGTGAATATACTCTATCTTTTTTGAACGA
TTTATATTATTGCGGGAAGTAAAATTGTCCTATCCTAGTTTGACCCCTAAACTTTTTACA
AGATATTCCTTTGAAAGAGCAAGTGTAGATTATATGTGTCAGTTTTGAGCTCTAGAAATG
CGCGGGTTTTAAATTTTCATATCACAAAAGTTTTATAGTGCAACTTTTGTACAAAAACCA
ATTTTTTACCAAATAGAGAAACTACTACTCGTATATAATCTGAAATTCAGGTACACATGC
GAAGCGGTGAACAGCGTTGGAAAAGTCAGACATGCGTTCTCGTTGGATCTCATAAGCAGT
GTACCTCCAAATATTTACGAAGGACCACAATCTGTTAGCCAGAATCTTGGAGGATCAGTA
AGTTTTCAGTTTTTATTTATAATTAGAAAGTTTAAAATTTAGGTTGTATTCGTCTGCAAA
GCCAATGGAAATCCAGTTCCCGATTACACTTGGTCATTTGATGGAAGTACAATTGGCCAT
ATTAAAGGAAGATTTATGGTATCTGATGATGGAACAGAGCTTCGTATATCAAATATTGAA
AAGAAGGATGAAGGATATTATTCTTGTATGGCTGGAAATCCAGTTGGAGCAATGAGTGCT
GATGCGAAACTTACTGTAATTGGAGGTGAAACTAGGAAGGCTGCGGCTCCACAAATTGAT
GAAGAGCTTCTACGAGCAATTGCTCAAAAAGCAAGACAAAATGTTGAAAATGCTGTGGAG
AAGACAAGAAAACAATTAACACAAGATAAAGTTACAAATACCAATGATTTGAAAAGACTT
TTCCGCTTCTCTACTCCAAAGCAAGCTGTCGAATTGTCAAAAGCCCGGGAGATTTATGAA
GAATCAGTTAGACTAGTTAGAGAACATGTTGAAAAAGGATTAATTCTGAATGTTGATGAG
CTTCACCCAAAAAATGTTTCATATGAATCAGTGCTTCATGTGACTCATGTTCAAGCTCTC
ATGGGCCTCAGTGGATGTCATACAGGACAATACAAGAATCCATGTACTGATACGTGTTTC
CATCATAGATACAGGTAATATTAATAGACTATGAGTATTCTATCAAAATAATTGTGGGTC
AAAGTAGTTGACAATGTTTGAATTTGAGTTCGAATTTAGAAAATTAAAGCAATAACCTAC
CATAAAGAGTAATTTGAAAACTTCTGGTTTAACCAAGAAATAAGAAACTTTCAGTTAATT
TTTTTTGGAAAAATCCAGGCAAGATCTCACGAACGAAACTATATTATTTACAGATCATTC
GATGGCCAATGTAATAATAAAAACAAACCAATGACTGGAGTTTCCCTAATGCCACTTCGA
CGTCTTTTGAAACCTGTATATGAGAATGGATTCAATACTCCAGTTGGTTGGGAAAAAGGA
CGACTCTATAATGGATATCCACTTCCAAATGTTCGAGAAGTTTCCAGACAACTTGTTGCA
ACTGAAAATATAACTCCACACTCAAAACTTTCATCAATGGTTATGCAATGGGGACAGTTC
GTAGATCATGATCTTACTCATACAGTGACAGCTCTTTCGAGACATAGTTATGCTACGGGA
GCTTTTTGTAATAGAACTTGTGAGAATTTGGATCCATGTTTCAATATTCCGTTATCACCA
AATGATCCAAGAGTGAAGAGTGGAAGGTGAGAATGCTAAAATTTTAGAATCTAGTTCTCC
AACTATAATCAGTTTTCAGTGCCAAGTATCCGTGCATTGAATTTGAACGTAGTGCTGCAG
TTTGTGGATCAGGAGAAACATCTCTTGTCTTCAATCGAGTTACCTACAGAGAACAGATGA
ATGCTGTAAGTTTATTTTACTTTTCATGATCTTTTCTAATTTTTTGTTCATCACAGGAAT
CTTATACAATTTCCAGCTAACCTCATTCCTGGATGCATCAAATGTATACGGTAGCAATGA
AGTTCAAGCTCAAGAACTTCGTGACACTTATAATAATAATGGGATGCTCCGATTTGATAT
CACTTCTGAAGCTGGAAAAGAGTACTTGCCATTTGAGAAAGATTCTAATATGGATTGCCG
TCGAAACTTTAGTGAAGAGAATCCGATTCGTTGTTTCTTGGCTGGAGATCTTAGAGCAAA
TGAGCAACTCGCACTTGCTGCAACTCACACGATTTTCATTAGAGAACATAATAGAATTGC
CAAAAAATTAAAATCGATGAATGGAAATTGGGATGGCGAGATTATTTATCATGAAACGAG
AAAAATTGTTGGAGCTATGATGCAACACATTACCTACAAACATTGGATGCCAATTATTTT
TGGAGGACAGGTAAGTTGTCGGATCCACGAGTGAAACACTTACATTGATTAATTTTTACT
TATAGGCGCAGATGAACAAGTTCGTAGGAACATATCAAGGATACGATCCGGATGTAGATG
CATCCGTAACAAATGCTTTTGCTACTGCAGCTTTCAGGTACAAATTAAACAAGCATTCGC
AAAATTTTACAATTTTTGAACAAAAGATCCAGCCACCTAGGGGACTCGAACCCCTGACCT
TAAGATTAAAAGTCTCACGCTCTACCAACTGAGCTAAGGAGGCCCCGGCAGCCCGGTTTC
AAAGACCAAACAGTTTTTTGGTACTTGTCATGCAATATGTACGTTTTTCAATTGTACTGT
TGGTTTCCATGTACATGCATATTTATGATCAATCTATCTAACAATCTCTCTATCTCAAAA
ATTCCAAATGTACATAATTATAAATTTAAGATTCGGCCATACAATCATCAACCCATCTTT
ATTCCGTCTTGGAAATGATTTCATGCCAATTAAAGAAGGGCATATTGCTCTTCATAAAGC
ATTTTTCACCCCTGAATTGGTTCTGACACAAGGAGGCGTTGACCCCCTTCTACGTGGATT
ATTCGCAAGTCCACTGAAACATCCGATGCCAACTCAACTACTAAATATGGAGTTAATTGA
GAAATTATTTATGAAAGGCCACGAGGTTGGTTTGATGATTGGAAAATCATCATTGAAATC
TGAAATGATGAACATTTTAAACCGGAAATGAATGAAATTTCAGGTATCATTGGATTTGGC
AGTCATGAATATTCAAAGATCCAGAGATCACGGATTACCGAGGTTTGAACGGAAATTGAA
TTGGACTTTCAGAACAATGAAAATTTAATTTTCAGTTACACAGAATATCGAAAATTCTGT
AATCTTCCAGTTCCGGTTCAATGGGAAGATATGAAAGGATACATAAAAGATGACATGATT
ATTCAAAAACTTCGAGGATTATACGGTGTTCCACGTATGTTTCTGAAATTAGACAATTCT
ATTTTAATAATTTTTCTTAAAAATCTGGTATCTCACTGTCGTATTACAAATATCTCTTCA
ATTGCGCTTTCCTAACCCTACAAGTGGGCGGAGTCATCGGTCACACAAGAGACAATGGTT
GGCGAAACCCGACTCATGTCGGCCACTCAGATGACGACCCTTTTATAAGCGACTGCAAAC
ACACTTAGCGACGACGCTTTGGCGAGCGCAATGAATGTTTAACCATCTTTCGGCTGAATC
CATGATGCCAATTTTCAAAATACTGAGCGCATGAAATGAAAATTTTGACTAATTTCATAA
GTTTTGCACATTCAGAAAACATTGACTTGTGGGTCGGAGGAATTGTCGAGGAGAAGTTGG
AGAATGGGTTGTTCGGTCCCACTTTTGCATGTATTATTGGCGAACAATTCAGGAAAATTA
GAGATGGAGATCGGTTCTGGTGGGTGGATGACGATGGAAATTATAAGCCTGAAAAAGACG
TGTGGGAAATCTGAAATTAAAATTTTCAGGTATGAAAAGGATGGAGTTTTCACACCAGAA
CAGCTGCGGGAGATCAAAAAGATCACACTGGCAAGACTTTTCTGTGATAACGGGGACAAC
ATTGATCGAATCCAGGTGAACATTTAGAACGGAACATGAATCTGAAACTATCTGTAAACT
TTGTAGAAGGACGTATTCATGTACCCAGGAATGGACAAGGAGAACTATGGAACATGTCAA
GAAACGGAAATGATGAACTTGAGAGCATGGAGCAAATGCTGTGATAATGTGTGTCCGACA
ATGCTAGATAGAATTCTTCGAAGGTAATTACAGTTGCTTCAGATTTCTAGAAAAACTGAA
AAATAATAAGAATGTGTAGGTGTGTAATTATGAAAAATTATGCACCAGAAACTGAAATTT
CGGGGTACTGGAAAAATGGCGTCATTTGAAATTATCTTGGTATATAACTTATGAAGTAAA
TAAGTAAACATATCGTATTGGACATTTCCCAAATTAGTTTCAAGATTATTTTCTAGTGTT
TCAAATATTATGCATTAACCCATTTTTGTCACTGAGCCCGATGTTTTCGAAAAAAACTCT
ATAATTCAATAACTGAGACCTCACTTAAAAACCCGAGTAATTCAATTTTTAGGTTTTATT
TGGATTTAGAGTTAGGTCAGGTGTAAACAATTAATGTTGACGTCAAATTGTTTATGAATA
TACTCTCTCATTGAATTGTAATCCCGGAACAAAATACCAGACAAGAACATAATAAGGTTT
TAATCTGATAAGAGCAGTATGGCTTTCATTAGGTTTAGATTTTAATATTCATAGTAAAAG
TTATTTGAAGGATATTAGACCTGGCATGCATGCCTACGATCTATTTTACCTCTGTGATTT
GATGTGAACGTAGTACATATTTTCTGATTTGTTCTTCTTGAATTTTATTTATTTTGTTGA
AAGTTCAATTTGAACAGATAAGAAAAAGTACACGAGGCAGGCGTAGTTTCAATATTCTTC
AATTTGGAGTGTTTCAAATTCGCACACTGCATAACCTTTAACTTAAAAAAAAACCAAATT
TCCAATATTCAGCCGACATCGTGGATCCCGTCTCCACGGATGTAATCAGAACGGGATTTG
GAGGCCTGAAGGTGCTAAGTGGATTCCACAAAATGAAATATGTACTGAATGTGTTTGCCA
GGTGAGTTTTCAAATTTTAATCAGTGTAAAAATTATTTGTTTTCCAGGGAAGCCGTGTTT
GGTGTTCGACAAAAGAAGATTGTTCGGACAATCGAAGCCCATTTTAATAATTTTTATTGG
TTGTTTTCGTTTTCTTTTAAACTCTGTTGTTCAATTTGCTGCTTCTATTAAGTATCTCAA
TTCCTTCGCTGGTGCTTTCCAATTCCGTATTTTCATTATTAGCCTTGCGTTAAATTGCCA
TTTATTTTTCGATTATTGATTTGAAAAACTTTTCTAAACAGATGCACGACTAATAATGAT
AATACGGTATTATATTTCTAAAATATAAATATAAAATTCCAAAAGTTCTGAACAAATTTT
TCCTTCAATAATCAAATTCTTAGAATCAAATTTTCCGATAGTTATTTTTCATTTTCAGAT
TCAAACATCAAACCGAAACTGAAAACGTCAAAAATATTTAGTAGAATGAAAACACGTAAA
TAAATAGAGTGATAATAATGGAGAGGGAAAAGATACAGAGACCGGCGAATTCGTTGTTCA
ATTCGATTTGGTAGCCGTCTTTGCAGAGACCGTAGTCGATTTCAGTGTCTCCTTGAATTT
ACGAAGCTCGTCTTGGGTGCGGCTCCACGGGCGGATTGTGCACGTCTTTTTCTCACTTGC
AATTGAACCATCAAGCTGTGGAAGTTTACATGTTGAAGAGAAGAGTGAAGCAGTTTCAGA
TCGAACCCTGTAAAATTGAATGATGAGGAAACAGTTAATCTCGAAATATCAAAATGTTTT
TCAATTAAACATTTTGTAAAAACTGAAAACTTAAGTTCACACTCAAACTAAGTACCTGCA
AAGTGGTAAAGGGCTTGTGGCTCTATCTGGCAGAACAGGTAAAACTAGATGACTTCCGCT
TGATGACTTTTTCATATTATACGGATATAAATATATTGGAATTGCAGCGAATAGTAGAAC
TAAAACTCAAAATCTCAAGAAAAAAGTGGGCTGAAAGAAAGAGAGCAGGCGTGAAAAAAG
AGAAAAATATTTCGAGCGCTCCAATGCACCTGGCCATCTAGTTCCAGCTTCTTGTGCTCG
CCGTCGTCACTCACAAATTACCATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1124, 1631..1785, 1865..2008, 2052..2191, 2330..2426, 2477..2592, 2647..2775, 2908..3147, 3410..3536, 3582..4213, 4433..4825, 4879..4984, 5056..5469, 5525..5616, 5910..6144, 6223..6281, 6335..6453, 6795..6918, 6989..7094, 7146..7282, 8052..8160, 8207..8266
1001..1124, 1631..1785, 1865..2008, 2052..2191, 2330..2426, 2477..2592, 2647..2775, 2908..3147, 3410..3536, 3582..4213, 4433..4825, 4879..4984, 5056..5469, 5525..5616, 5910..6144, 6223..6281, 6335..6453, 6795..6918, 6989..7094, 7146..7282, 8052..8160, 8207..8263
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved