Caenorhabditis_elegans Locus C08D8.1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C08D8.1
Caenorhabditis_elegans
C08D8.1
V
C08D8.3
4328..4407
6129
GAGGAAATACGGTATTTCTTTGTACCTACTGCTATGAACCTTTTTTGAAAGGGTTCAGG
ATGCTTACTAATTTTTTCATAGGAAACTACTATCGGCATCGGATTCAGTGTACCAAAAAA
CTTCTGCAACTTCGGTGTAACTAATATTAGATTTCTAAAAATTCCGATATCTCAGAAATG
AAAGCGAAATAGCAAAAAGTTGAACAAGCGACTGAGATTTTTGAAAGTTTTGTCAATATA
CCTCAGTTTCTCAAAAAGTATATTTTTTAAACATTGAATAGCTTAAATATATGTTTTTCA
TGATGCACATTTCCCGGTCAAAATTGTTTAGAGTAACAATAGATTCATTCAAAAATGGGT
TCAAAAACTGACCGAAACTCTCGATTTCATTTGAAAATTTCACTTCCCTGTATACACACA
GTGAACGATTTGTTCACAATCTGCCAACCACAAAAATATTAATCCGGTTTCCAGTATTCA
TCTTTTTTATTTTTTAATTACAGCCACAAACAACACGATCACAACGAACGGACCTTTTTC
GCCTACTACCTTTAAATTTTATTGGTTTTTTTTGTCATAATTATTATTTGCAGCACGGGT
TGTATTTTTCAATTTTTACAAATTTAATCAGGTATTAAACTTGTAGAATAATTAATGAGG
AATTTATAATTGTTCTTTCAACTTTTTTTTTTGGTTTTTCGAATTAATAAAACCATTCAA
AGCAGAAAAGTAGAGACATGAGAGACTGTTTTTGTTCTTTTGTTGAATAAAATTAAAATT
GGTACATGTGTTCAGCATGATAACAATTGATAAGAGAACATAACGTTCTCTTTCTGTTTT
CTTTTTTTGAAAAAAAAGTAGATATCGACGGCTAATTTGATTGATGAGACTACAAAACGA
AAACCGTACTCGTGATTTCTAGTTTGTGTCCTTTTTCGGATTTTCAACGCTATTCGCTCA
GCCGAATCTTTTTCATTTTATATTTCAGTTTTTACAATCAAATGTGTGGGTTTTCGCAGG
CCACCAGGAATATTTGTCAACTGGGATCTGTTTTTTTCTTCAACTTTTTCTCATTTTTCA
CACTTTGTAAGTTTTGGAAATTTTTATTTTATACGCCGTAATTTTTAATTAGACTCTATC
CGAAAGAGACTATATCTATAGGAAAAACTTCCAAATTCAAAAAAAAAGACGATTTTTCTC
GTTTATTTGTTAACGATTTTTTGCCAATGTACAATATTGTCAAAATTATCACGGGTTTCT
GCTGTGCGAAGTATACTTTAGAAAATTGTTAAATAGAAAATTTAAATTTTGCACGGCCTC
TCTTCATTTCAAAAAATAAATAAATTGACGTGATGAACTGTCTCTGCGTCTCTCATGGGC
GAGAGAGTGAGCTTTTTGAGCCGAATTTGTACTGAAAACGGTAAAATAGGCCGGAAACGG
CTGATAGTGAACAAAATCTAATAAAAATTTACTAACTGCCTGATCAAACACATAGAAATT
ATATGAAAAAAGGGCAAAATTGTAAATCACCTATGAATACGCCCACATGTGAAAGTTCAA
AATTAGTGATTTTCCAGACAAACCTGATTAAAGCCGGCGATCCGCTGATAAATCTTTAAA
TTTTTTATTAATATATTGTCAATTAAGACTAAGTGTATCTATTTTTATGCAAATATCTAG
GTTAGTGATGTTCACGACGCCGGCAGACGGAAAAACACAAGGTTACCTCGAAAAATGGAT
TTTTTCGGGACCTCTAGTGATCCTTGAAAAGAGAAATTTGAAAATTGAAGGCCACCATTT
TGTAGATAATTTTTTTCTGATTATTTTCTGTTTTTGATGAAGGTTTTTTGATGAAAATTG
ACGTCGGCATCTTCAAAACAAGAATTAGGCCTGAAAACTCCAAAAATCGTTAAAAAACGA
CAATTTTTGACGGGTTTTCCTAATTTTACGAGACGCGCCAAGACATAATCAAAAATTCAA
CATCACCAAAAGTTGCAAAATTCTCTAAGGAAGAGATTAAGATGTCAATCACCTGATTTG
ATCAAAAACTGATTGAGTAATTTGAGTTTTAAGACAATGCGATTGTAATTTTTGGTCAAC
CGTAAGCTTATTAGTTGACTTGAACGCTTTTGAAAGCATATAGATCGGTAACCAGGAAAG
CTATCAAGAAACTTTAAACTGCAAAAATAATCTTGATAACACAAGAAACATTTTCTATGT
GCATAATACTTGGCTATTCTCACAAAATATATAGTTTAAGCTATGTAAAGATTCAATGCT
TTGAAAAACTTAGATAGAGAAGCCACGAAGGTATTCGAAATTATCCGTTTGCACAATCAA
CTCAAAGAAGCAAAAAATAACAAAGTGTGGATTAATACCGTCTGATACCTTTTTCATATG
TCACTTTTTGTTTTTCCCGTACGGGATCCCGTCTTTACAGTCGACAACCGACTGAAACCG
AGGCCTCCAATGAATAACTCAGGTTGTGAACCCTGTCGGGAAAGTCTCATCAGTTTTCCA
TCAGTGTACGACAAAAAATATACCGTATTTCCTCTATTAGTCTTGCACCCCTATTAGTAT
TGCACCCCTACGGACCAATCGAAAATCAGTCATGCTGACTCTATTAGTCTTGCACCCCTA
CGGGTCAATTGAAAATTAGTCTTGCATTCAAGACTAATAGAGGAAATACGGTAATTGGGT
ACGATAGGAATACGGTAGGTTTATAAGTTATGTAAGTTTCTACAAATATAACTACTTCAG
TTTCTCTGTACCAAACTTTGGAGAATTTTTTATACTTTAAAGATCACTGAAATAGTGAGC
CGTTGTCTACGAGATCAAATATGTCCGAAAATTACCATTTGGTATCGGTCCTAACAGATC
AGTATTTATACCAAAGTTGTTTCTTCGGCAATATTTTGAATTTAATTTAAAAACACATAT
ATTATTCAATTTTCAATCTCACGTGAGAGAGTGTGAGAGAAAAAGAGGAATTTTGAAATA
AATGAAATTGAGAGAGGCCGTGATTTTGTAAATGTTTTATCAATTTTGTCAAAAATCGTA
AGGTTTCCTCGTTCAAACGCAAAATGCCGAAAAAATAAAACTTTGAAAGCGGCTTAAAAC
AATAAATTCCAATAATTTTTAGCCGCTCTATCACAAACAATTGTCGAAAGTGTAGCCGAA
GAAAAGGGAATAAATCGACATGCGGGTTATTACAGGTAAAACTGTGAGTTTTATCTAAAA
ACTGAAAGTCTTCAGTGCGTTCCTCACATATCTTGTCTTCACATTTGGTCATTTCGTCGC
CACACCAATTGTGGAAATAATAACACCGAAATGGTCAATTGTCAGTGGATTAGTGGGTTA
TGCAATGTTTGAAGCTGCATTTTTGTGGATGAACGAGTACTTTTTATATTTCTCTGCAGC
TTGTGCAGGATTTTCTGGATCGTGTGAGTTTTTTATTTTCCTTAAACATTCATAGAATTT
TTTAAGTATTGTGGACTGGTCAATTTGATTATTTGGCTCAAAACTCTCAACCACACACTT
TGGATCGGAACTCCTCTAATTTATGGGGACTGTCACAAACATCGTAAGATTTTTTAATAA
TACTGGGGATCGTTGCAAGACCCATGATCACATGAGCGTGTACCTTTGAAATGACGTTTG
AAGTTTCTGGAAATGACAAATAAATTATTTTTCAGATTAATATTTGGTGGTGCTTACCTA
CTTATTTTGTACCGATTTCAGACTGGAAATGAGTTTGAGATGCCTTTGGTAACTTAAATA
TTTATTTTTCCTTCTTTTATTAAGTTTTTCGATTTCAGATTCGTCTAGTCGTTGGCTCAT
TTTTTATCTGCACGCTTGTTTCCATTGCCATCGGACTTTTCCTTCCTCAGCCCGCATTCA
AAGTGGAAAAATATAAAATTGCATATTTTAAACATCTTTGTAAGTGATTTTTGAACTTGT
TCAATACTTATTTCTATATCTAATTTTTAGCTGAAATCGTAAAAATTTCATTTGACCGAA
ACTTGATGCTACTATTCTTCATGTTTTTGTACACTGGATTGGAATTATCTTTCTTTTCTG
CAGTATTTCCTACAATGGTCTCATTCACAAAATCTCTGGGAAATACTAGAGATTTAAATG
CTATTTCATCTATTTTTGTCGGAATCGGAAATGTTTCTGGTGAGTTTCTCTCTGCAAATT
CCCCCCTTGTCTCTTTCTCACTCTTCCTGTTGGCGCCGCCCACAACACATACAAACTGCT
GCGCTCGGCGAAACTCGTGGAGTGTCGGCGGCGCGTGTTGGTGTAGTGCCGCTGGGAAGT
TCTATCATCACTTGTTACATCCAATGATGAGAGTTTGCGACTAGGGCGGTCTTACACAAT
CATGGTGATTCTAGTCATTCTGATGGTACGTAACATTATACAAGTATATTAATTTTGGAA
AAACGTCTCTTTGGAGAGTTTAGTTCTTAAATGATTTTTTAGGCTGCTTTGCATTGTCTG
TTCTTGGCTCTCGTGTTCGAGAATTTGGGAGAAAGAAAATGGTTTTGTTGGGTTCCATTC
TTCACATGACATGTTTCCTGTTGACGTTTTTGATGTTCCCCGATGAATCTCCGTTGAAGC
CAACCGAAGCTTTGGGTTACATTTTGCCGAGGCAAGGGATTCTAACTGAAATTAAATAAT
CTCCCAGAGTTATTTTCCAGTCCGTATATTATCTTAGTGTGCGGTTTTCTTTTGGGAGTT
GGTGACACAATATTCAATCAACAGTGTTACACTATTTTGAGTGATATTTACGATCATGAC
AAGCGAATCGAAGCTTTTGCAGTTTATAGATTCTATCAGGTATTGGCGAATTGTCTTTTC
AAGCACAATCTTTTTCTCAGAGCGCTGCCAGTTGTGTTGCCATGTTCTATTCAGCTCATG
CTCTTTTGAGAACGCATGTTATTATTCTTTCAATGTTTTGCGTAATAGCTACAGCTACGT
TTTTTGGAGTACGGTAAATTTATCTAATCGAAACAGAAATTTAACTATTAGTGTTTTTTT
TCCAGGGTTCCAGAAAAATATCTAGTAAACCCAAGTGCCGAAATGCTGGAAGTTAAAGAA
TGTGAGCAGCAGGAAAAACTCATGATCTAATACTAACCAATGCTAACTTTTACAGATTAA
TTCATCAATGCGGTGCAGAGGATTTTCATGTTTTAAGTTATATATTACTTATCTAGAGAA
AACGATCAATATTAGAGATTTTTTAAATTTACAACAGACCCGAAAAGCAGACACTTCATT
GTAATTTAACGAAATTTTGAAATGTCAGTTTAAAGGCACAAGCTGTTTCTTGAAGGGGAT
CTTGCCACGATCTCACAATAAATGAAAGTGATACTACAGGTGCCACATACATTTTACAGA
TTTGAACAGAAAAGCAGAAAACATGTTTATAACATTTTAAATCCTGCTCACAATCAAAGA
TATTCAGGATTTATCATAAAACAGTCAGCGCCCATTCACAATCAGCAATGTCCCATTTCC
AAAAACTGTTGTTCTGCAAGATTGTATTCTCTGGATGAGTAATATATTTCAATTTTTGTA
AATATTTTGAGTAACTCTAGAAGAATTCTGGCATCTCAAGTCTCTCTTCAAACCATTAAC
GGTTGTCTTGTGAATATTTTTGTTTTCTTGAGCTTTTATTGACTTAGCTGTGATTAAGAA
GAAAATAACTTTACGCTGTGATTGAACATTTATTCACTCAATTTTTAGAAGTTATTTATA
CAAATTTGAAAAAAAAACCTGTTTTAAATGCCACTGCATTATGAAAAATATCACTGTTAT
CACAAATCACGGAATTATGATCAGACAAAGGGGGTGAATGACTTTGCTTGGCTTAGGAAT
TGCAAAGTTACGCATTTTCACCATCGAATATTCAGAAATTTCAGTTAAAAAATGGATAAC
ACAATTACTTTTACTTTGGCAAGAGGAACGAGTCAGAAGTAGGTAGCCTAGAAGGCAGGT
ATCCATGTACCCCACTTTTTTTACTTGAAAAAATAAGGTATTCTGTCATATATTTCCCAC
CGTCACGGTGTTCGTTCCTTAATTATTTTTTAGCCTATAATTTTTGTTATTTCAAAAAAC
GTCTTATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1085, 3142..3214, 3255..3442, 3486..3582, 3695..3767, 3818..3938, 3990..4178, 4482..4650, 4700..4838, 4880..4992, 5045..5129
1001..1085, 3142..3214, 3255..3442, 3486..3582, 3695..3767, 3818..3938, 3990..4178, 4482..4650, 4700..4838, 4880..4992, 5045..5126
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved