Caenorhabditis_elegans Locus rol-3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rol-3
Caenorhabditis_elegans
rol-3
V
C16D9.11
5340..5439
7039
TAAATTCAAATAGAAAAATTTCAGATTTCGTCGATTTCTGATTCTTCATGACAAAATGA
TACTTGTTACGAAAAACAATCACATTGTTCAAACTGACAAAAAACTGAAAGTGGTGAATG
TTGCGACTGAATTGGAAAGAGTTGATCATATTCTACCATTACGATATGCAACAATATCTC
ACAAAATTGAGTTCAGTGATGAAATCAAATTTATTGATGGAAGTAAAACGAATCTTCAGT
GGACATTATCCCCACCATTAGAAGCTGGAACTGTACTCTTCAAAGTTTCAATTTTTCGAG
AAAAAATGGGAGGCCAAGACCCACCGATAATCACGATTCAGAGTGAAACTAACTTCACAA
TCCCGTCCGAAGTTCTGGAAGCTTGGAGTTCGGCGCAGAGATTTGACGTCTCTGTGCAAG
CAATGACACCGTGGGCCACAGCAGTACTCAACAGAACCGGACTAACAGCGCCAGTAAAAC
CACCAACTTCTCCAACTCAATTGAGAATATTTGCAACTCAACAAAAAACTGTCGACGGTC
CTAGAGCTCTCATTTCATTTTTCTGGGGTCCTCCGAGTGAATGGAATGGAACACCTTATC
AGTACATTGTCAACTGCACAAAAGATGATGGAAGTTGGATTGGTGGACCTGTTACTACTT
CTCAATCACATTATTCATTTGCTGTAAAATCTGGAAAAGTGTCTTGTCAGGCAGCAGCTG
CAAATAGCCAACGAATATTGGAAGTTTTTCAGAGTTGATCACAATTGACAGTTCTGGTAA
GGAAGCTTCTGAAGTTTATATGTTCTTATTGTGCAGTATTTCAGAACTTAAACCTCTTGT
TAAACTTTTTGCAATTGATTCCACAAATTCTCTGATATCAATTAATGATCTCGCTCATGA
AGAACCGAGAAGAGAGACACGGCAAGTTGCACAACCAGTCAAGGTATACTTTCTGTTAGA
TATAATTTTTAGAAATAAACTTTTAGTTAGAGTACCAAGCAATGGCATTCATTGGGGAAG
ACTTGTACGCTGTCAGGAAAGAAGGAGAGTCTGCACAGCCAGTGTTGGTTCAGATTGATA
CAAATCATATTGATAATACAGTACATAAGGTAGGTTTTATTTTAAAAAAATTATAAATTT
CAAATCACCGATCCTTCCTTCTCAGGTGTCAATTGGTGGAGATGTAACACGAATTGATGC
AATGACTTCTGATTGGGTCGGAAATCGTTTAATATTTGTTGCAGGCACAAATGTATATCA
GTTATCTCTTGAGCCATTTCTTTCAACTTCACTTCTAAACCCGCATAAGTTGATTCAACT
AACATCCGCGACTGATGCAAAACAGCTTGCTTATGATCCTTTTATGAAGTAAGTTCAAAC
TATTAAAACCCTTAATGCGTATTCTGGTAATAGCACTGCCTACTTGCTTACCAAAAATGG
ATCACTATTTGCACTTGATATGAACAAGAATACTGAAGCTAATCTGGCACTAACTGTATC
ATGTTTGGCAAGTCAAACTGTTACTTGGATGATGACTGAATTTGCCTGGAATCGAGCTTC
TTCACCAAAAATTTATGCGCTTACGTGGAATGGATTGATATATGTGGATCTTACTGAAGA
CTCACAGTGCAACGAAGTAAGAATTGATTGGACCAAATTTGGAGATAAAGGTCTCAAAGA
TATATCATCATTTGCAATTGCTGATAAACTATTTGCATTTGTCACTTCTTCGGAAATGCT
TATTTATGGGAAAGACACTGTGACACCGATAACTATTGCAAATCCACCACTGAAACAAAT
ACTCGCGGTCAGTCAAAGTAGTCAACCATATCCGGAAAGATCTTGCTTCGAACTTCCGTC
TTCAAAAGGGATTGTATTTTCAATTGTGAACGAAGGGAAAACTGGATCATTCTTGGAAGT
TACAAAGAGCTCATCATCATCTTCCTGTCAAGAAGTTAGTATGCCACAGACCCAATACGA
AATATATTTTACACGGAAAAATACTGATAAGGTGAAGCACGTAAGAAGCTTCTCTGACAG
AATCCACGTGGAAAATGGAATTCTTGACAAGGAAACCGACTATGATGTAACTGTAACTTG
GCTCAATAGATATTCACCAGCAAGTGGAGTTTCTGCTTCAAAATCTTTCCGAACAGGGTT
TGGGTACCCATCCGCTCCAAGAGATCCTCATGCGATTCCAGTTACTCCAGATACGGTTTA
TCTGTATTGGAATTTACCAGAGACGCTGAATGCTCCAATATCAGAGATAAAATATAAGAT
TTCACAGCAAGCAGCAGGAATTTCTGTACCGACTTCAATTGCAGTCATTGCTCTTTCTGA
AACTGTTTCTTCAAACATTTCATCAGATACAACATCTTGCTTAATCAATCCATGTCGTGT
TAAAATTGCAAATCTTCGACCTTCAAATGAGTACAAGTTTTGGGTAACAGCTACTCATAT
CTCTCACCTGGATGCTGCTACAATCCTGAAAGATGACGATGCAGTGTCATCAGAAGCTGT
TGCTAGAACTCTTGATGTACCAGGAACATTGAGACCTGATAATGTTACTGGATCTTCGTT
ACTTCTACGATGGAATGGATTGGAACCAGAGCATCGACCAAGCTCAATTGCAGTCCAGTA
CAGGGAGTCTGGTGGCGCTAATAATGAATGGCAATTTCCAATGAATGTATCATTTGAACC
AGATGTAACAACTGAACTTGTACCAATTACCAACCTTTTGTCAGCTACTTCATATGACTA
TCGATTTGTGGCAACCTACACAGGAACCTATACAATTGATGGAAAAGTACTAGCATTCAA
AGAAGACTACCTCCAATTGCCGCAACAAGCTCGAACAAAAGCTGGAGTACCTACAGCTCC
TCAATTTGTGGAAGCAAAGCAAGATGAAGAGGGATGGATTGTAACTTGGAAAGAACCAAT
GAGTGATGGAGGATCTCCAATTACAAGTTATGCCGTTGAGACTAGAATTAATAAAACCGC
AGAATGGGAGATTGCTGAAAGAGGATTAGATGGATGGAAAACATGGTGGAGACCCGGAAA
ATCAGATACAACATCTTCAACTTCAACATCATCGACCGAAGTTTCAGAGTTTCGAATTAG
AGCAGCAAATATTGAAGGATTTGGAGCCTATGCTTATACAGAAGATAAAAAAGAGGAGAA
AGAAGAAGAACCAAGTTCAGTATTACCGTATCTACTGCTTCTTTCAATCATATTCCTTTT
GGCAGCAATGATTTTAGTGGCTTGTTTTTGGTGTAGGTTAAAGTTTAAGTTTTCCTAGAA
GTCCAAAAACCTGAGAATATTTAAGTGAAATCTCGCCGTCGTCAACAGCAGAAGAAACGT
GAAGCGGAAGACGAAAGAAATTGTATTCGACTTGACGTAGTTGCCAATATGAATTTTTCC
TCTTCACATCAATCTCTTCCTCCAGAATATGAGAGTGAAATGAGAAGTTCGTTGTCCTAC
ACCGTACTTTTTTTAAATAATCTAATTTCAGATCTTCCGGTAGTCAATTACAGTACTGTT
ACTTTCAATGATTACATTGATACGTGTGCATATGGAATTGTTCATAGTGGTACTGCTGAA
GAAGTACCAATGAGTTGGGAAAAAGACGTTAGAGTTGCTATTAAAAAGTTGAAGCCGAAT
CATTCATTCCAAGAGAAAATGATGTTTATGAAAGAAGCAATTCTTTTAAAGTAAGTTTCA
TACAAATTTAGAATGGGATTTTTTCCTAGTGAAACGTTTTCAGTAATCTCGATCACCCGA
ATATCGTCAAAGAACTTGGTGTCTGCATTACACCTGGACAGGAATTGATTTTATTGGAAT
ACATGGAAGGTGGAAACTTGTTGAAGTTTCTTCAAAAATCGTAAGGCTATTTGTTTCTCA
TCAAACCTAAAAGTTTGATTTTAGAACCCCAAATGAGTACCAAAGTTCTGAATTATCTCC
ACGCGATCTTCTCTCAATTTCTGTGGATATTGCCCGTGGCATGAACTATCTTGAGAGGTA
GGTTAAGTTTTCTCTAGGCACTGGCGGCCTTCCTTTTCCGTGCTTCCGTAGCGCAGTAGG
CAGCGCGTCAGTCTCATAATCTGAAGGTCGTGAGTTCGAGCCTCACCGGGAGCAAGCTTT
TTGTTGGTCTAATTTGAATTTTTTTAGACTTCCTCATGTTCATAAGAATCTTTCCGCGCG
GAAGTGCCTTCTTGCCGGCCGGCCAGGTGTGACTAAACTTGAGATGGGAATGTCGAAAGA
GTTGAGCAATGGACAAGTGAATCGTTCGGATTTGGAAAATATGGAAATTGTCCGTTGGAT
GGCGCCGGAAGTTTTGAAAGATTTCCAGTTTTCATCAAAGAGTGATGTTTGGGCTTATGG
TGTACTTCTCTACGAAGTTTTTTCATTCGGAGAAGTTCCATATGGAGATAAAGACAATAG
AAGAATTATGACTGATGTCAGAAATGGAAGTGTTCTACCAATACCTTCCTATTGTCCATC
GAAAAGGATATACAAAGTTATAAAACAATGTTTGACTTCTGATTCTACTAAAAGGGCAAA
CTTTGCAACAATTTTGAAGATTTTCGAAACATTTAGAGACGATCAAAAGTGTCAGGTACT
TTGAAAGAAATTGAAGAACATACATATTTGAATACTTTCAGGATGATAAACCAATTCAAT
TCAATGATGGAACAGACAACACGAATTTTAGTGCATCACAAGATAGTACTTCAAGTCGTG
AACCTCCATCTCCATCCCATCGAATGAGAGATTTCATTGATACAAGAGATTTAGAACCAC
CGTCCCCATCACATTTGAATCAAAGTTTTGGAGGATTTGAACATCCATATGGTTAATTTT
AAATTCTGTGTTGTCAATATACATCTGATGTATTTTCAGAAGGCGAACGCCCTGCAACAA
TGTGGAATGGAAGTGGCGCACGAAACTCTGCCAAAAATAGTATTGGAAGATCAATGAAAA
AAGAGAAATTAAGAAATCCCATTCATTCGATGGATGATCTAGTTGCTAGAAATCAGAGAC
CATTGAGCATTCATTCAGAAGATACCGAATCTACGGATTACGGAGGTTGGTTTCAAGAAT
GGGGATCGGAAATTATTTGAATTTTCGAACATTCCTATAGTTATTATTATGAGAAAGGCT
AAGGCAAAATAAATTGTCACAATTTTAAATTGGCAAATCCAGATCTCCAATTTCTTTTAT
CCCACACCGCTCTTTACTTACTCTTCTCTGCGTCTCTTCTCTCGCTCCCCACGACTCCTC
CTCTTTTGTACACAAACGATGGACGTCTGCGGAACCCGCGTAGTGTCGGGCGCGGCGAAA
AACTACCCAATAGTGTTAGGCGTACACTAGAAGGCCCGTGAAGACACGAATTACCGTCTG
ATAACTAATGACGCTACCATGGCTGTAAACCAGAGGCCGATTACAAAAAAATTTTTGTAA
TGTTCTGAATTTTTCAGCTTCATCATCAATGTATTCTCCAGGATCTTCCAATCGAATTTC
AAGCCAAGTTGACCCTCCAATTGGTAGATTGAGCTCTGCTCCAGGAATTGGCATAGTCAA
TGATGCATTTGAGAGCAGTAATCCATCGCTGAATTTGAGTAGAAGTTGGGCCGGGCTTTC
AAGAGAAGTGAATCAGAATCCTGCTGGTGCTGGTAGTAGTGGAACACTTCCACAGCATAC
GAACTCTGCTGGACATTTGAGACTCCCTGGGGTCCAAGTTGGAGCAGGTGGCGGCCGTGT
CTACAGAAATGCCTCTGGCGGTGGTGGACCTTCAAATCGAGGCCGCATCAGTCAAGTCTA
GAATCCATAATTAAATATTTATAGCATGACATCAAAGAATCTTTGTTTTCTATCTCAACT
CCGGTCTTCTCTTCATTTTCATTCACGACCACTAATTTTCTTTCCCATTTGGACGGTTGC
TAGGCGCCAATTTTCGTTTTCAGATTTCAAAACATAACCAAAGGATGTTATTTTTATTTT
ATTTTTCCGATTTGTCCCTCATTCTTTATCAAGAGATATTTTAAGTTATGAAGTTGTGTT
TTCATATTTCTTCTTTTTCGTTTCAGAAATATATCAGCTATTACAAAGAGACCTTTCAAA
TAACCTTTCGGAAAGAACGAATTTTGAAAAGTCTTGAAAAAATAATGGTGGTTCATAAAA
TTGACAACTAGGAGTTTTAAAAAGTATTTAAAAGTTTCAATAAGGCACTATGATCTAGGA
GAAAATGAACACGTGAGGTGATAATATAAATGTTGAAGAAAGGCCTACCAGAAGTTGAAT
CTTGGAGTCTAGAAATACGATCAGTTGACGTAGTTGTGAACATATTTTGGATTCAAATTA
TTCAGCATATCAGCATTAAGAATGTGTGTTCGAACCTAAATGCTTTCAACCAAAAAATTG
ATTATTACATCGTGTTCAGAATTCTGTCAACTGTTCAAATTTCACTAGTCTATCCACATG
GGATCTCGAAAATCGTAGTTCGCTAAATATTTCTAGTTTCATATTTAAGATTTGAAATTC
AGCCTTTGAATTCAAAATATCTCATCCTAATTCAAGAAGCCATTATTAAACGAGAGTGAG
AAATAATGGAATTTAAATTTTAGTTTTGAACAACGAGCCCGTCTTGTTGATTACTCCACA
CTGTATTACAAGCGAATGAAATTTGAACACGTGGTTGACTGCATTAGGGTTCGAAATTAC
ATTCTTAGAATCAAAATCAAACTATCAGAATGTTTTTACCAGTTTGCCAGATGATAATTT
TCTAAAACTTTACTATCTCTAGATCTAGAGCTCCAAAACCGTAGTTATGGTGAAGTTCTC
AAGTTTAGACTCTTAGACTAAAGGTATTCAATCTTGGTAGGATCTCATTTCAGTAGGGCA
TACTCTTTTTTTATTTTTTTATTTAGAGTTACCTCATTCTTGTATGTTGCCAAAAATCAT
AATCACAATTTTTCGTATCATCTTCCAACGATCAAATTTGTGGATTTCAGTTTTTACAGA
TCTGTGACAGTTTTTCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1165..1367, 1413..3271, 3325..3709, 3763..3879, 3924..4016, 4167..4614, 4661..4850, 4899..5084, 5477..6039
1001..1108, 1165..1367, 1413..3271, 3325..3709, 3763..3879, 3924..4016, 4167..4614, 4661..4850, 4899..5084, 5477..5817
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved