Caenorhabditis_elegans Locus unc-70
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans unc-70
Caenorhabditis_elegans
unc-70
V
K11C4.6
8733..8802
12060
TATCTTTTTGAAACTATTTTTTTGAATGAATATTTGCAGTTCTAAAAAGTAAATCGTCA
TTTCAAAATTGTTTCTCATGCAAAAATAAAGGCAAGATCAAATGTGTTTTTGAATAGACC
TGCGTTTTTCAGATCAGTAGATCAATCAGCGTCCCTAGAAATATTCTCAAAATTTTTCTC
GTGCCAACTCAAACATTTGCTCCCATATTTTCGTAATTTCTTATAGTATGCTTTTTTCGT
CGTCTTCTCCTGCTACATGTATTCAGTGCTAATCCTAATCCCTTCTGCTAATTTTATCCG
CTTTCCCATCCACATCCACACACATTCTTTTTCTCTTTTTATTGGCTGCTCCCACTCGAC
ACTCATTTGGGCCACAAGGACTTGGGGGACCCATGTGTATGTTCGAGTTGTGGGGCTCTA
TGTGTGTGTGTGTGTGTGTGTGTTTGAGTGCGCCTCTACGCAGTTGTCGAGGGCCCCAGC
CGGCGGTCTCCCCCAACGGCCACTGCCCTGCTTCTACGTCTTTTTCTTCTTGTCCTCCAC
CTCCCCAACCACTGGGTGCCCTTGCTTTTGAACCAAACGGGCAGTGCTCCCTTTTCCTTC
CACTTATTTGATTCGTCCCAATGTTTGTGTCTCTCACCCTCTCAATCTTTTCATTACTTG
AATACATTGCTTTCTAAACTTTTTCTTCCTTCTTTTCTGATTCTTCTTGTTTTCCACCCT
TTTCCAATTGGCAGAGCATGGGAGCAAAGGGCCCTCCTACTAATTGCCAATGCTCCGTTG
TTCCACCATTTTTTTTGTGTTGTTTTTTGTCGTCTCCTCTCCATCCAGCCGTCGTGTATT
TTTCTCTACGCCTCATGAACTATTTTCATCAACTCGCCAATTCATAAGCCCCCTTGGCTT
AAATGAATGCGAGGGTCCCTTTTTCTGTCAATTTTTTTTCTCGCCTCTGCTCAGCAACAC
TGGAAATCGAGACAGGTTTTTATTAATCTATGATTTTTCAGCAAAATTTCGGCGGGACTT
GCAACGGCGCGAAACGTCGTCGGCAATATGGCTACGGTGAGTTTTTTTTTTCAAAAATTT
CAAAACATAGTAAAACTTATAGAACTCGAATATGAGCAAAATTTTAAGAGATTATCGTCA
AAAAAATTACTTTTATGTATTTTGAGAATAGAACACAATTAAAAAAAAATACACACAATA
TAAATTTTTCAACTAGAACTTTTAATTGAAAATTATTTTTTCTCCAGGTCGACGGCAATT
CAGGCGCCTATACCCAAGATGAGGACTATGATGACAACTCGTCCGCCCGCCTCTTCGAAC
GTTCTCGTATCAAGGCACTAGCAGGTGAGTGACACTTTGAATCTTCTCTGAACCCTTCAA
GTCCATTAGCTTTGGCCGAAACCAATAAAAAGTTTTTTCAACCGCTATAGTGGACTAGCT
TTTTTTAGTTGTGCTCATTGAGCCGATATTCACTGAACCAAACTCTAAAGTTTAAAAAAA
TTTAAGAGGTAATTTTCAGTTTCGAATGCCAAAAATGTCTTGAAAGATTTTTTGCTGTTT
ATCAGACCGTTCATTACTTCTTGAAAACTGATAACTAAAAGTGTCGGCATGCCGTCAACA
TTTTATCTAGAAATCAATAGAAACTCTGATAGGAACTTGCAAACAAACACTATTTTACTT
GTGCATTCTCTTTACAATGTCGTCGGTGGATGACGAGCATCATCCTTCAATTGAAGTTGA
TATTCCTGACGTTTATGAAAGTGCATCTGACTGTGAAAAAACTGAAGACTGCACCTATCT
AGGATCTATTCTCAAGGCGAAAAAATCATTGCGAAAAACCAAGAAAGTCGCTAGTCCTGG
TATCTATCCGGGCTCGGCGGGTGCTCTTTCATCTCTTTCAAATGGCCTAGCCGATGAGAA
TAGATCGCCAACTAGTGCTGAAGTTTCTGATTCAGTATGTGGACAAAAATCTATAAATTC
AGTTGACTTGAGGTTCAGAGGATTGAGAGGTTAGACATTTTAATGCGAATTTTTTGGGTT
AATTCTTCTAAAACATGTATTTTCAGATGAACGTGAACTCGTGCAAAAGAAAACATTTAC
AAAATGGGTCAACTCACACTTGGTTCGAGTCAGCTGCAAAGTACAAGTGAGTAATATTTT
TCGAAACCCCGTTTATTAAAATTAATAATTTTCAGGACCTCTACATGGATATGCGAGACG
GAAAAATGCTCCTCCGACTCCTCGCAGTTCTTTCCGGTGAACGTCTGGTGAGTTGTATTT
TTTTTTCAAAAAATTATTCAAAAGCGTCATTTCAAAAAAAAACTCCTTCCTCAAAAAAAA
TCAATGAGACGAGGCGACGTCTTTTTGCAAGCAGCTTGCAAGCTTTTCCCGGAAGAAAAG
AGATAGACTGGCCCGAGAAGGAAAACTAATTGAATTCGAAAATGTGCAAACTTTTTTCTT
GGTCTTTCAAAAAACTTCCAAATTTTCAGCCGAAACCGACGCCGGGAAAAATGCGTATCC
ACTGTCTTGAGAACGTTGAGAAAGGTTTGCAATTCTTGCGCAATCAACACGTGCATCTCG
AAAACTTGGGTTCACACGATATCGTTGACGGAAATTCACGCCTCACGTTGGGTCTCATCT
GGACGATCATCCTTCGATTCCAGATCCAAGATATCACATTTGAAGACGCTGACAATCACG
AGACACGTTCAGCGAAGGAGGCCTTGTTACTGTGGTGCCAGATGAAAACTGCTGGATATC
CAAATGTCAACGTCAAGAACTTCTCAACCAGTTGGAGAGATGGTCTTGCATTCAATGCAC
TTATTCATAAACATAGACCTGATCTCGTAGACTACGATAATTTACAAAAATCGAATGCTC
TTTACAATTTGCAATCTGCTTTTGATACCGCAGAAAATCAATTGGGATTGGCCAAGTTCC
TCGATGCCGAAGATGTGAACGTTGACCAACCTGATGAGAAATCCATTATCACTTATGTAG
TTACATATTATCATTACTTCAACAAACTGAAACAAGATAACATCCAAGGAAAACGTATCG
GAAAAGTGATTAATGAGTTGATGGAGAACGACAAAATGATCAATCGATACGAAACTCTTT
CATCTGATTTGCTCGAATGGATCAATGCCAAGATCCAACTTCTCAACGAACGTCATTTTG
AGAATAATTTGGAAGGTGTTCAAAGACAGCTCACCGAGTTCAACGACTACCGTACTCAGG
AGAAACCACCAAAGTTCGATGAAAAGGGAGAGCTCGAAGTACTTCTGTTCACTCTTCAAT
CAGCTATGCGTGCCAACAATCAGAGACCTTTCGTGCCGAGAGAAGGAAAACTGATTGCTG
ATATCAACCGAGTGAGTTTTTTTCCTAAAATCTTATTATGCCTAATTATTAAAAAGTGCA
TTATTTATTTAAAACCATCTATTTTCAGGCATGGCAATCCCTTGAGAAGGCAGAACACGA
ACGAGAACTTGTCCTGAAAGAGGAACTCATTCGTCAAGAGAAACTCGAACAACTCGCAGC
CCGATTCAACAGAAAGGCCGAGATGCGAGAGACTTGGCTCACAGAAAACCAACGGCTTGT
CAGTCAGGACAATTTCGGAAACGACTTGTCTTCGGTGGAAGCTGCCACCAAAAAGCACGA
AGCCATCGAGACGGACATCTTTGCTTACGAGGAGCGTGTTCAAGCCGTCGTCGCTGTTGC
TGGAGAGCTTGAAGCCGAGAACTACCATGATCAAGCCAAAATCAATGAGAGAAAGGAGAA
TGTTCTTCAACTCTGGAACTATCTTTTCCAACTTCTTTTGGCTCGCAGAGTTCGATTGGA
GTTGTCAATGGCCATTCAAAAGATCTTCCACGATATGCTTCTTACTCTCGATCTCATGGA
TGATATTAAGAGCAGACTTTTAAGCGAGGATCTTGGAGCCCATCTTATGGACGTAGAAGA
TTTGCTTCAAAAGCACGCTCTTCTTGAGTCTGATATTAATATTATTGGAGAACGAGTTAA
CAATTCTATTGCTCAAGCTCAACGCTTCCGAAATCCAGATGGACCAGATGGAAGTGGATA
CAAGCCAGTTGAACCAGGAACCATTGATGAGAGAAGTGATGTTCTACAAAAACGTTACAA
GGAGCTTCTTGATTTGGCTGCTGAACGTAAGCGTCGTCTCGAAGACAACAAGAGACTTTG
CCAGTTCTGGTGGGATGTTGCTGAGCTTGAACATGGTATTAAGGAACAAGAGCAAGTTCT
TTCGTCCACTGATACTGGCCGTGATATTGTCACTGTTTCGCATTTGTTGGCCAAACATAA
GAACGCTGAGAACAACCTTCGCGACTTGGAGAAGTACCTCGATCGTCTTGATGTTTCTGG
AAAAGAATTGCAAGATGAAAGCATCCCAGGAAGTGACAACATTCCTCCAAGGCTTGCCGA
GATTCGTGATTACATCAACAAGCTCAAGGAACTCTCTGCTTCTCGCAAAGAAAGACTTGC
CGGTGGAGTCGAATACTACCAATTCTTCACCGACGCCGACGATGTCGATCGCTACTTGTA
TGATACTCTCCGCGTCATGTCATCCGAAGACGTTGGAAAAGACGAGGGAACTGTTCAACT
TCTCCTCAAGAAGCACGACGATGTCCATGACGAGCTCCAGAACTTTGACCAACACATCAA
GGTTCTTCACGCCAAGGCCGAGTCTCTTCCACAGGAAGCCAGAGAACATCCAGATATCAG
ACAACGATTGGACACAACTCTCAAGCAGAAGGCCGAACTCGAAAACCTTTCTCAACTTCG
CAAGCAGAGACTTATCGATGCTCTCTCCCTGTACAAGTTGTACTCGGATGCCGATTCAGT
CGAGTCTTGGATCGATGAGAAGGGAAAACTTTTGGCAACATTGGTCCCTGGACGCGATAT
CGAAGAGGTTGAGATCATGAAGCATCGTTTCGATACTCTTGAGCAAGATATGAAGAATCA
AGAAGCTAAGGTTACTAACGTCAATGACTTGGCTCGTCAATTGCTTAATGTGGAACATCC
AAACTCCGACGACATTCTTCACCGTCAAAACAAGCTCAACGCTCGCTGGGCTCAACTTCG
CGACATGGTCGATCAAAAGAGAAACGAGCTCGAGAGAGCTCACCGCCTCGAAACTTTCCG
CATCGATTGCCAAGAAACAGTTACTTGGATCGAGGACAAGACTCGTGTACTCGAGGATTC
GGACGCGTTGACCAACGATCTTTCCGGTGTCATGAAACTTCAAAGAAGATTGTCCATGAT
GGAACGCGATTTGGGAGCGATTCAAGCCAAGCTCGACTCGCTTCACAAAGAAGCCGATGA
CATCGAAAGAGAACGACCACAAGAAGCTCAAGCCATTCGTGAAGATATCAAGAGAATCCA
CCAAGTCTGGGATATCCTTAACAAGAAAGTTCGTGAGCACGAAGCTAAACTCGATGAAGC
TGGAGATCTTCAACGCTTCCTCCGTGATTTGGATCACTTCCAAGCCTGGCTTACTGCCAC
CCAGAGACAAGTTGCCTCAGAGGAAGAGCCACAATCCTTGGCTGAAGCTGAGCAACTTCT
CAATCAACACGCTGCCATCCGTGAAGAGATTGACGGATACGCTGAGGATTACAAGAAGAT
GCGTGCAATGGGAGATCGTGTCACTCAAGATCAAACCGATCCACAATACATGTTCCTTCG
TCAACGTCTTGCTGGACTTCAAGAAGGATGGGAAGAGTTGCAGCGAATGTGGGACAACAG
ACAACATTTGCTTTCTCAAGGACTCAACCTTCAAATGTTCCTTCGCGATGCCAAACAAGC
AGAGGTTATGCTCTCTCAACAAGAAAACTATCTCGCCAAGGACGATATCCCACAATCTTT
GGAGCAAGCCGAGAACCAACTCAAGAGACACCAAGACTTCATCACCACTATGGATGCCAA
CGACGAAAAGATTCGCGCCGTCGGAATGTTCGGTGATCAGCTCTGCCAAGATGGTCACTA
TGCCGCTGACAAGATCCATAAGAAGGCTAGAAACATTGATGAACGTCGTGGAGCCAACCG
CGAGAAGGCTCAAGAAGTACTCAAGAAGCTGAAGGACGCCTTGTCTCTCCAACAATTCTT
GTCCGACTGCGACGAGCTGAGAGAATGGATCGAGGAGAAGATGATCCGTGCTCAAGATGA
GACTTACAGAGACGCCAAGACTATCACCTCCAAATTCGTCCGACATCAAGCATTCCAATC
CGAACTTGCTGCTAACAAGGAACGTCTTGACCAACTTAAACATGCTGCCATCAACCTTGG
TGACGACAAGCCAGAGTACCACGGAACCATTGATCCACAGATCGAGGAACTCGCTACTCA
ATGGGATGAGTTGGAAAAGACTACAGAGGAGAAGGGACAGAAGTTGTTTGATGCTAACCG
CCAACAACTTTACGTACAAAGTATTGCTGACATGAAGGAATGGGCAACCCAACTTGAGAA
CGAGATGACTCGTGAAGACCAACCAGGAGATCTTACCACTGTCAATGTGGCCATGCAAAA
ACAACATTTGATCGAAACTGAAATGATCAAGAAGGCTCAACACATTGATCAACTCATGGA
GATGGAGCCACAGCTCGAGGAACTTCACCCAGACGAGCTTGAAAACATTAAGGCTCATCG
TTTGGCAGTTCAAGAACAACTTCAAAGACTCCAGGCTCCATTGGACGACCGACGTAAGGC
ATTGGAACGCAAGAAGGCCGCCTTCCAATTTGGTCGCGATGTTGATGACGAGAAATTGTG
GATTTCTGAGAGACTTGTTCTCGCTAAAGCTCAAAATCTTGGAGAAAGCCTTCCAGATTG
TCATCGTCTCCAGAAGAACCTACAACTTCTTTCCAATGAAATCGACAACCACGAACCATG
GATCAACCAGATCTGTAATAATGGTCAAGAGTTGATTGACGAAGGACATGCTAACGGACC
AGCATTCGAGAAGAAGATTCAAGAACTGCGCAGTGCTTGGCAAGAGTTGAAGGAAGCCGT
CAAAGACAGAAAGGGAGATCTTGGAGAAAGCGAGAAGGCTCATCAATTCTTGTATGATTG
CGGAGAGGCTGAAGCCTGGATGAGCGAACAAGAATTGTACATGATGCAAGACGAAAGAGG
AAAAGACGAGTTCTCAACCAAGAACCAAATCAAGAAACACGAACGCCTTCAATCCGATAT
TGACAAATTTGCTGATACGATCCGTGCTCTTGCCACCAAGGCTCACAAGTTCGTCGAAGA
GAAGTCACCACTCACCGAACAGATCCAAGTTCGTCAAGCTCAAATCGAGAAGCTCTACGC
AGGTCTTCAAGATTTGTCGAAGGAGCGCAGAAAGAGACTCGAAGAGACCTTGGAACTTTA
CGCTCTTCATCGTGAAATCGACGATCTTCTTCAATGGATCGCCGACAAGGAAGTTGTTGC
AGGAAGTCAAGAGAACGGACAAGACTACGAACACGTCCAAATGCTTCAAGAGAGATTCCA
ACAGTTTGCTCGTGACACCGAAAACATCGGATCCGAACGTGTTGCCAATGCTAATGATGG
ATGTGATACTCTCATTGGTCACGGACACACTGACGCTCCGACTATAGCATTGTGGAAGGA
TTCGTTGAATGAGGCCTGGGAGAATCTTCTGGAGTTGATGGACACTCGTGCCCAAATTCT
CGAGGCTTCTAGACTTCTTCACAAGTTCTACCACGACTGCCGTGATTGCTTGTCAAGAAT
CATGGAAAAGACTCATGCTATGCCTGATGATCTTGGACGTGACTCAAGCAGTGTTGGTGC
ACTCTCCAGAAAACATCAGAACTATCTCAAGGATATTGCTGCAATTGGAGAACAAGTTGC
TCAAATCGAAAGAGATGCCGCAGAGCTTCGAGATGGTTACGCTGGAGACAAGGCTCTTGA
TATCGGATCTCGCGAAAGCGAGGTTGTCAAGGCATGGAGGCATCTCCGCGGACTCTGTGA
CGCCCGTACATCTCGTCTCATGGATACTTCTGATCTTTTCAAGTTCATGAATATGGTCCG
TGATTTGTTGTTGTGGATGGATGAGGTGAAGAGAGAAATGAACTCACAAGAACGTCCGAA
GGATGTGAGCGGAGTCGAGTTGCTCATGAACAATCATCAATCGCTCAAGGCTGAAATCGA
TGCTCGCGAGGAGAACTTCAACGCGTGCATCTCATTGGGACGAGATCTGCTCAACAGAAA
ACACTACGCATCAAGTGAAATCGAGAAGAAGCTGATCAAGTTGACAACCGAAAGAGCCGA
AATGATGCGCAGATGGGAAGATCGTTGGGAATATCTTCAGCTCAGTAAGTTTTTTTCAAA
AATTAATTAAAACTGTCACTAAAACAATTTATTTCAGTTCTGGAAGTGTACCAATTCGCC
CGCGACGCTGCTGTCGCCGAATCTTGGCTCTTCGCCCAAGAACCATATCTTATTTCGAAG
GAATACGGTAGAAACCTCGAAGAAACCATCAAACTCATCAAGAAACACGAGGCGTTCGAG
AAATCGGCATTCGCACAAGAAGAACGTTTCTTGGCGCTCGAGAAATTGACAACGGTAAGT
GAAACTGGGGTGGGAGAGAGAGAGAGATGAGAGAAAAACGAGAGTGTGTTTTATAAACGT
CCTCTAGAGCGTTGCCGCCGATGCACGGGTGGCGCAGTTGGTTATCGCTGCGCCTAGCGC
TTGCGAGGCCGATTGTTCGACTGCGCTTGCTGGCCTCGATGACGATTCACCTAGCTCACT
CAGACATACAACTGGTGATAAAAAAATTTCGTGTCTTAGAGACCATTTTGTACTTTTGGA
ACTTATTTATAGTTTTAATTTCAGTTCGAATTGAAAGAAACTCAACACCGCGAGGAGGAG
ACCGCCAAGCGACGTGGTCCAGCTCATATTGGAAGTCCTTCTAGGTCAACTCCAGCCGCG
GAAACATCTTTCGGCGCCCAGGATGATGGTAAGTGAAATGTTTAATCTTAATATATTTGG
TTGTGTGCATTCATTAACCAACCTCCTAAGTGTATTGTGTTTGTTCTCACCCGTCGTGTG
CTTTGTTTCAGACGCCGATATAACCCACAGCAGTTTGGAGGGACACCGAAAGTCATCACA
TGGTCAGAGTTGTTTTCCAGTTTCATTTACCCTAATCCACCAAAAAAAGAGTGTATCCTC
TATGTTTTCGACACATCTTCATCTAATCATCTTTGATGTCGTTATTAGTCGTTTTGTATC
GTGCTGTTATTTTCAGAGAAACGATTGGCCCACTCCGAGTCAAGCAGCTGGCGAAAGTCA
TTGGCGCGCGCCGCAAAGTTCGACAGCAAGGATCCAAAGGGTATAGTTGTTGTGCTTCTT
GATCTTATCGATGTAGTGAAGTGATATTGAATTTACATTTGTTGCTTTTAAGATTAGGCT
GGCTGTGTCCTAATTATTCAAAATTAATGTTTGCTGTTTCAGGAGCCAAACAAGGAGAAG
CATTCGAAGGAACGCTTATCAGAAAGCACACTTACGAGAGTCTCGACCGGAAAGCGGCTA
ACCGCTCATGGGAGAAACTTTACGCAGTGTTGCGGCAGAATGAACTGTCATTCTACAAAG
ATCCGAAGCATAGGTAAGTCGCGTTAAGAATCAAAAGAAGATTTACTTCCATCCTTTCAG
AGATGAATCTGTGCATGGAGAGCCACCAATGGCACTGCCAGGATGCTCTGTCAACGTGGC
ATCAGACTATCAAAAGAAGAAGAACGTACTGTCGCTGAGGTTACCCATCGGCGCCGAGTA
CCTATTCCAATGCGGTAGCGAAGAAGACATGCAGCGATGGCTCACCGAGTTGCAAGTCGC
CACGGGGCAAGCCCAACTGGAAGAGGCTAGTAGATCACAGACGCTACCAGGTAACTGATT
AAGGGAGTGATATATGTAATCAATATGATCATTTTTCAGCAGAAGGCAGTGCCACAAAGA
AGAAGGGAGGATTTTTCTCTCGAGGCAAGAAGTAAACCGAATCAGTGGGACGAATTATTT
GTATCGACGTCGAGGTAAGATTTTTTGAATTTTACTGGATTCTCCTAACTTATTAGAAGC
CATGAAAAGTATTTTAATTTAAAAATTATAATATCAAATGAAAACGCAAGTTTAATAAAA
GATTAGTTCGTAATATTCTACAATGTTGCTGTAGAAAAGTTGCTTTAGTAATTTTTATTC
TGTCAAAACCAACATTTTCCATTTTCAGCTGGCTTGATTCGATAGGTTACCTGATATCTG
TGTTATCCATCGGCAGGATTACTCAGAAATCAAAAACCAATTTTGAATCTCTCCGTCTCG
ATTGGCGAAACAGTCTTTCTTTCACACCGACGCTTCAGTCACTTCATTTATATTTTATGA
ACCATTTTTTCTCAAATCAATGATTCGTCCCATTTGGTTTCTTGTTTTCTTGTTTCAAAT
TTAAAGTTTCACCCCCCTAATCCCAGTCAGCCAATGAGCTCCCCAATTCATACGGTTTCA
TTCTTTTCACCACCCATTCTTCGTTTTGTTTTGTTTCCCCCCTTTTTTCTCTGTCCTAAA
CGTCCCCCCTATTCCATATTAGGCATTAATATTATATTCGTTTAAATTTCCCCCCTACAC
TTTCTCATACTTTGAAAGCTTTTTGCTTATTAGCCTTCATATTTTTTTGTGCAGATTACA
AGTAGTAGAACCAAAGATAGCCTTGCCCGTTCGTCATCGGTCTCTTTTTGATTGGGAAAT
CGGCGTCTCAATTATTATTGATTTTTCTTAAATATACAATTAGTATTTGATATTAAAAAT
CAAAGAAAAAAAAAGAGAAATGTGATGTACGGGCACCAATTCGAACTCGGTTTGTTGTAT
CCCCTTAATTTTTAATGTAGCTATCTTTCGTTATTTTTTGTCTCTTTCAGCTTCACACTG
CTTTTCAATTCAAGAAATCTCTTTTTTTCCCACCATACCAATTCTATTGGTTCCAATTTT
GCACCAAAACCCTTGCTTTCATTTTTTAGACTCCAAGAAACTTCCACTTTTTCTTTCACA
CGAATAAAAAAGGTTACTGTAGATATGCTTCTTCCCCTTGGGATATTTTATGTATGTGTG
TATTGCGTGTGGCTTCATGTTCCTGTGTGCTCAGTTTATCCCCTTTCCCTTTCTTCTCAC
AACTGCCTTTTTTGTTCTAATGATCTTTTTTTCTAATCTGTCTTATTGTTATCTCCCCCA
CTCGAATAATCTCTCGTCCCGCAACTCTTTCTAACCGACTAAGCCAACCCGCCTCCCTTT
AATGTCCCTTTACCTACAGTAATCCCCACCAGAGGAAGTAGTGAGACCCAGAATTTTTAT
GAGAAAATTCGCTTGTCCTTCCTTCGATTGCCAGCTTAGTCTTTATTTGTGAGAAATTAT
TTGGATTTCTCTTGGATTTTATTTCTGTGGCAGCTTTATTTCTTTTTTTGTTTTTCACCT
TTGGTTCACTTTGGAACTAATGAATCTTTTGACTAAACCATGGTTTTTTCTAACATTCTA
ACAACACTCTTGGGGCCATTTTTGGACGACGATTATGTATTGGTTTGAAATGGAAAAAAA
CCAAAAAGTTGGAGAGAGAGAACGAAAGGAAGTCGTCGTTTTGCCACCAGTTTGCTTTGC
TTTCTGCAAAATTGCCGTCGAAATGGACTCGAACCTCGTCAAAAAGCATTGTGCGTTAAG
CTTTGAAGCCGTACATAGAAAATTAAATGTTTTGTGGTTATTTTCTGTATAGAGAGGACA
GATGTTAAGCTCGCCGAGCTATATTTATGAGTCACACAAAATAAATTTTGTAATCTTTAA
AGTTCTGTCTTGTTTCAATGGAAAATTTTCTTGCTGGATAAATTGAAAAATAACATTTTA
AACCTTAACCACTCTCAAGTATTGTTTTCAACATTGATTTTTGGACTGTGACCGTCAAAT
TATTGACTTCACAGAACAGGTGAATGAGAGGTTCAACTTGTTTCGAACTGGGTCTGCAAA
ATATTTATGATTTACTTGACTACTTCCATCATATCAAAAAACGTTGTGCAGCTTTAAATT
C
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1247..1343, 2066..2145, 2195..2266, 2489..3370, 3448..8323, 8377..8573, 8844..8967, 9462..9612, 9660..9889, 9939..10033, 10228..11060
1047..1055, 1247..1343, 2066..2145, 2195..2266, 2489..3370, 3448..8323, 8377..8573, 8844..8967, 9462..9612, 9660..9889, 9939..9991
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved