Caenorhabditis_elegans Locus tag-115
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans tag-115
Caenorhabditis_elegans
tag-115
IV
JC8.15
1336..1481
4131
TTTTCACTTTTCAGTGTACCTCCGTTGCGTCGGAGGAGAAGTCGGAGCCACCTCCGCTC
TTGCCCCAAAGGTCGGACCACTTGGATTGTCTCCAAAGAAGATCGGAGAAGACATCGCCA
AGGCCACCCAAGACTGGAAGGGTCTTAAGGTCACCTGCAAATTGACCATCCAGAACCGTG
TTGCCAAGATCGACGTTGTCCCATCTGCTGCTTCCCTCATCGTCAAGGAGCTCAAGGAGC
CACCACGTGACCGCAAGAAGGTCAAGAACGGTACGCATTTAATGCGTTGGGTCGGGAGTC
GATATGCTCTCATCCCCTGGTCTCTTACTTCATAAGTTTGTAAAAGTTTGTGACTTAAAG
ACTAGTAACCTAAGTGATTTTCATGCTCCGTGAGTTTGATTTTTCCTGGGTTTGGTGTTG
TCTCGTCCCAACGGGTTGTTTAATCAATCTAGTTTAACGTTTTGCACGTTTCCATTTCAG
TGAAGCACAATGGAGACCTCACTGTTGACACCATCATCAAGATCGCCAGAATCATGAGAC
CAAGATCGATGGCCAAGAAACTTGAAGGAACCGTCAAGGAGATCCTTGGTAATATTTCGA
AAACGATAAACTGTTTCTAAATATTGTATTTTTTCAGGAACAGCCCAATCCGTTGGATGC
ACAATTGATGGACAACACCCACACGACATCATCGAGTCGATCGCCAATGGAGAGATCGAG
ATCCCAGCTCAATGATCTGTCACTTGTTTTTGTTGTTCCAATAAATTCTTGTTACTATCT
GCGTGTATTTTGATAAATATCTCAATAAATCATGCAAGACGTCTAATTTAGAATTTGTAT
CGAAAGACACTGGTGTTGGGATTCATTTGTTATCTATTTCTGGTAAAAGAACTCGTGCTT
CGTCGCTTTTCGAAATCGATTTTTGCGTGGAGAGAAACTGCGCTCTGATGAATTTTTTCT
TCAGTTTATTTTATTTTAAAATATTTTCGCTTCATTCAGAAATGGCCTCGTGTGAATCAA
TGTGCCCAGTCGCTGAAATAAATTTTCGAAGCCGGAATCATCTGATAGATCAATTAGAAG
CTACTGCATCGACTAGTTCAGGACCCCGGTCAAAATACGTTGCAGATCCGACGAAAATGG
TCAAAGAGTACTCACGATCAGCTGCTGACACCCATAAATACAACAAACCGGAACTATTAA
GGCCTTTTCCCGTTCTACAACACACAATAGACTATCTTCTGGATTTGTACAGTCCGTTTA
AAGGTGAGTGTCATGTTTGGTGTTGTGGTAAATGCTCCAATTATGGTGCAAAACGTCTCA
GCTCAGTCACCGCCGACGCACCTTGTTTTCACGCATTCTCGGTCAGTTTTCTCGAGATTC
AACGCGTCCAGAAAGTGTGCTATATAGAAATAAAGAGTACTTTATAAGGGCCATACACGG
TTTAATTTACCCCGGCTATGGTAGTTTAACGGTGCTACAAATGATTTAATTTTTTTTCCT
TAAAAAACTTTATTGATTTTTCATCAGACAGGCGGTCAGCGATCACTTCCAAACAATTCG
CATCGATTTTTTCGTTTGTTTCGGATCGTCTACGATCAATTCGACAGGATATGATTATGC
AAAACTTGCGTGGAGATTTCACTGTAATTCTTATTGAGGTTGGAAAAATAAAAAATTTGA
GAAGAAAAGATCCTTAAAAACTATAAAATTTTGCAGAAAATGCTTCCATTCTACATAGAA
ACTGACGGAGCTTGCAAGATGGCAAAATGTCAGAGTTATGACCCGAAATTGCACGATTTT
CAGTTGGAAGAGTGCTTTGGAAGGTAGCTGGACGGCAAATCAACGTTCTTAATCAAAAAG
AAATCTGAAAATATTCCTTTTTTGTTGGAAAGTTCAAGAAATGCCTCAATTAGTGCCTGA
AAATCTCCTTTTCCAGGTTTTTTTTTATTTCGAAGTAAATTGAAATAAATCGAAAAAAAC
CTGAGAATGGCCGTTTCAGATACTTTGAAGTCTTTTTTTGAAATTTTCAACCAGAAAGTC
GTATTTTCAGGTTGAACGAACATTTTTATTTCAATTTTTGATTAAAAACTAGATTATCAA
TCTGAAATTAACAGTTTTTCGCCTAAAACGCCAGAAAGAATTGAAAAAAACGGAATTATT
TTTAATTCTCCATATTCGATTTGTAAAATATATTTTCGATTTTTTCGCAAAAATTGATGT
AAAACTGCCGATTTTTAGACCAAATCTATAGTTTCAGTCAATTTTTTCGAGTGACCAAGT
TTCACCAAAGCCTAAATCTTGGCCATCCAATAAAAATTGACCGAAGCTGTAGATTTGGCC
TAAAAAATCGGTGATATCGGTGATTAAAATAAATTTTTAAGCGGAAAAAATGCCTGAAAA
ACCGAAAAAAAAAGTTTAGCATTCGAATTATTAGGGAAAAAAAATAAAGAAAAAATCATG
AAATATAGCCGGAAAACGCAAAAATATCGAAACTAAGTCACTTATTTGAGCGGAAATTCA
GAAATAATACTTTTCTATTTTCTAATTTAAGTTCTCTGTGATTTTTAGCAAAAAACCACA
GAAACCTTTAAAATTCATAAAATAAAATATCTGATTTTTCAGGTGGTTTGAAGAAGTCTC
GAATTCCACTGATATTATCCCGAATCCCTTGATATCGGCCTGCTTCTTCTTCAGACAATT
ACATCGAAAATCATCAATTCTTCATGATCTCTACCTATTTCGTCGGAAACTACCACACGA
ATCATTTAATCTCATTCAAAGCATAATATCATCATTTTATTCCTCAAATTATCGCCGATT
TTTCGATATTTTCCAACAACTCGATCCACTTCTCAAGCACTCACTCTCGGATTGTGTCTC
AATTCTTCGTCAATCAGCGATGAAAAATATATCCGTGGCATTCAAGACTCCTGTCGCTAG
GCTTCCATCTCAATTGCTATCCGATTGGCTTGGATTTCCAGCGAATCTCGAATTTTTCGA
CGATTTTCTTCGTTTGTACAGTGTGATTCCTGATGAGCAAGGAAATATTCTGATTTCTGC
TCTACGACCACCCGTGGAAATTTCGTATCAAGATTTTTCTTCGAGACAATATGAATAAAT
TTATTGTGATTTATTGGATTTTTAATATTTTTGAATTTTTTTGTTATAACGACGCTTCAA
ATGCGTATTTGATACTTGTCAATTAATTTTTTCTTTGGTTTTTCAGGAAAAATCGCTTTT
TTAAAATTCAAAAGATAAAAAAATGACCGAAATTTATTGAAATTTAAGTTTTTTTGTTAA
AAAAAAAGCTTTAAAAAAGCAAAAAATATTAAAATTGAGGTTTTTTTTTCTTTAGAAAAA
GCGAAAAAAATATCAGTTTGAGATTTTTTTTTTCTATAAAAAGTGAAGAATATTAAAATT
TAGATTTATTTTCCCAAAAAAAAAGCGAAAAATATTCGAATAAATATTTTTTACGAAAAA
AGCGACAAATATTGAAATTGAGATTTATTTTTCCAAAAAATATTCAAATGAAGATTTTTT
CCAAGAAAAAAAACCGAAAAATATTGAAATTAAGATTTTTTTCAAAAAAAAGCAGTCAAA
ACACATTTAAAAATGTTGAATAATTCTCAATTTGAATATTTTTCGCTCTTTTTTGGAAAA
AAAATCCAAAAAAAAAACGAATAATATTCAAATTGAGTTTTATTTTTCCAAAAAAGCGAA
AAAAAGTCGATTTCCCAACATTTTTTAAAGGAATTTTCTTCTTTATTTTCTCATTAAAAA
TCAGCATTTTTATTCATTTTTATCCGATGAAAACGCCCAAATTTCCAGAACTAATGGATG
GTGTACTGATGGTATCGGATCTATCATGGATCCAACGTGGAGTTGCAAAAGAAATTCCAG
ACAAAATCAAGTTGGACGACGAAAAGCTAAAAGAGCTGATCGAAGGAGCAATTCCAGAAT
CAACTGATAATGAAACAGAGCTTGACGATGATGAAGAATCAGATAATGAGAAATTAAAAG
GACTACGTGGAAGAGGAGATGTTGAAATGAAAGATGAAGAATCAGAATTTGAAAAGAAAT
ATATGAAAGGATATAATGAGAATATCAAAGATGAACCAGAAGGACAAGATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1262, 1527..1657, 1716..1822, 2622..3131
1001..1262, 1527..1657, 1716..1822, 2622..3114
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved