Caenorhabditis_elegans Locus rps-23
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans rps-23
Caenorhabditis_elegans
rps-23
IV
F28D1.13
1403..1532
2804
aaattagcactgttcacacggaaatcaatcgattattctcttcctcttcagttcttctc
gagcctccttgatttctcccaatagctctactttagcttcagcacaatcgttgaaagtcg
ccactccatagacaacattgaagacggcgtaaatctgaaacgttgagttactttaggctt
tgaaaaagcaaaaaagtgtaatataacctaaatgagtcaaaaaatatttttttgttggat
aatgttaaaaaatacttacaccaaggaagagaactgcaaaaaatggcgcctgaaataaaa
taaagtatattcggttcgacccacaaaacaacttacgtagttaactaaacaatgcaaaca
ctctgggagatatgacagcactggtaccacatcagtgtaagctagaagccaaactaatac
aaaaagaatcacatgtgctgagtatgttaccaattgagacaccattctgaaaatattgaa
tatttatttttcttttaaagatcaaataaaaatcaaaggagaaaaaagaaggttttctat
cagtttttaattaaaaaaaaaaaaacaataaatttattattaattcgataatttttttta
ttaataacaattttatgaaattaattcaaaaactctactctgcaaacaattttgcaaaaa
acaaaaagaaaaaaatagcaacgctacgttgttttctaggccatggccgtggcggccacg
agtttgatgtgcaggctacctcgaggtacggtaacactcgtttcagctgttcatgccttc
tcttcaccagaaccgttgaatttttccccgaatcctaaaatttttttggctttttctgct
gaattcaactttttttcgctgaaattttgaaaataacaacatataattggtctaaaaagc
ttgtttctcatatatttgtttatgggttttgttgcattattcgttttatcgccatatccg
ttcgaaatataaaatttgtccttgtaatttacatttttattctaggtaatatgggaaagc
cgaagggactctgcacggctcgcaagctcaagactcatcgtcaagagcaaagatggaacg
ataagagatacaagaaggctcacattggaactcgctggaagtctaacccattcggaggag
cttctcacgccaagggaatcgttcttgaaaagatgtgagctttttataagattttaattt
tcgattttagctgtaagcgtgaagttaagatttcaaattcataattttcagcggtgtcga
agctaagcagcctaactctgctatccgcaagtgcgttcgtgtccagctcatcaagaacgg
aaagaagatcaccgccttcgtcccaaatgacggttgcttgaactttgttgaagtgagttg
ttttttttgaataactcaatctatacgaggtccagagtcacctctgagaatatgtatctc
ttcggtgctaggattgctcgaaaatgaattaggtactttatgcaaacagttcttgcgtta
tgctcatctgtttcacctccgtttctgacaaaatttatttaattaaaaaaatcaattatt
attttccaggaaaacgacgaagtgctcgtatctggtttcggacgttccggtcacgccgtc
ggagatattcccggagttcgtttcaagatcgtgaaggtcgccaacacctccctcatcgcc
ctgttcaagggaaagaaggagagaccacgttcgtaaatgtttgttgttcttgttattccg
acataaagttgttggggttaacccatatgatttttcttacaattgcataaaatttacaac
ctctaattgaaaatgaggcgtgaactgaacatggaaaattgagattgggagtcgtgttag
attgtagttggaattaatttttcaaaacgtgatcgacaaacttcaatttttttccaacat
acacgtagagaagcgtaaaaaatttgacttgctatttcctgaaatgcaagctcttttgta
ttttactgcgtgtttaacttttgttgattcgaaacgatttgtcttgttggatcctgatga
tccgaatctagagaaaagtgcttccaatataaccgtgagttattattgtacgaagaaaat
tagagagttgattaggataatgatgttcgatcaagatccattaaaatggcgaagtttcgg
aaatggctgaagtatgacgtcgattgccagtttatttcaagatcggagctggcagtgaaa
atatcacagggaagatgtcctcatgaatctgcaactgaaatcaaaccgtgaggggtttag
gtgttaaatttatgagctggtataaatctttagaacaactacaacaaaaaaaccgaaaag
tttctttttcaaaagaaaacgaaagcctctaaagaaaaaggataacagtctgttttctaa
tgagaacaaggaatcagtggtgagagctgtagttggtaggttttcaggttttatagtact
cgtaaaaagttctcaaggtaataacaagatgcatgaaattgattggacacctttgagttt
tcccgatcttgagctagtcagcggtacaatggtgactttcaaatgtgatgaaatgaatcg
aaaaaagaagagaaaaaagcatgaagagattgagtttgttgaatggtttgtgaacggaaa
acgaataaatccaagttggttcgattggagagtttccgtttcaatagatggacatctagg
ttaaaattgcgagaattaaaattcttaattttgaaaatccaggaatctggccaattggag
aaggtgatggtggtcattttgagtgtctgtcaaatggacagctca
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1173, 1251..1371, 1569..1804
1010..1173, 1251..1371, 1569..1715
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved