Caenorhabditis_elegans Locus C10C6.6
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C10C6.6
Caenorhabditis_elegans
C10C6.6
IV
C10C6.8
6061..6193
7885
CCGGGATCATATTGTGCAATATTTCATCGTTTCTGACATACTATAAATACAATAACTTC
CTTTCAGAACAAGTCTCCAACAAACTTCCATCTTATCAAAATGTCCAAGTATGGCTGCCC
AACCTCTGACACTGATCCAAACTCGGTCACAATGATTACGAAGCGAGGACCAGTGAACAA
GACATTGAAATCGGCTGCTCAATTGAATGCTGCTCAGCGTGCTGGAGTTGATATTTCGAC
CGAAAAGAAGACGATGTCTGGTGGCAATCGCCAGCACAGCGCCAACAAGAACACTCTGCG
GCTTGATGAAGAAACGGAGGAGCTTCATCACCAGAAAGTTGCTCTGTCCCTCGGAAAAGT
CATGCAGCAGGCTCGTGCCACGAAAGGTTGGACGCAGAAAGATCTTTCAACGGTTAGTTA
ATTTTAAAATGAGATCTTTAATTGAACATTTTATTTCAGCAAATTAATGAGAAGCCGCAA
GTAGTCGGCGAATACGAAAGCGGAAAGGCTGTCCCAAATCAACAGATCATGGCAAAAATG
GAGCGTGCGCTTGGAGTCAAGTTGCGCGGCAAAGATATCGGAATGCCATTTTCAACAAAG
CCACCAGCGAAGAAGTGATGAACTAATAATGTTACATCGAATAGGTCCAACTCCTGGTGT
CCCCACTTTCCCGTCTATTTCTCTCATTCTCCAGCCCCGAAATTCTCTTACCGATCCCCG
CGTCTCCTGTTTTCTTGGGTATCTCTTTCCGTCTGGCCTCTCTTACCCGTACCTTATCAT
GGTTTTTGTTCAACATTATTGCTCTTTTTGTTATATTTTTGTATTTATGCTAAATTTATT
TTCTTTCTGTACAGAAACGACGCAGGAGAATCTGAAATAAACGTATCATTTTAAATCCAT
GACTGTGACATGATTCAACTCTCCCAACGTTTCCATATCGTTTACAATTATACTTTAATT
CAAATTCGCATTGTTTCTAAATACAAAAATCGATTTTGCAGGGTCCTGTAGCCCGGAAAG
ATGGGTGTCGACCAACTAGTCGAGACTATTATACCATACAATTTAAGGTCTATAGCAACT
CATTTATATGTTCCTCCTTTTACAAGTGAGTCAAAGAATAAGTTAATGAGATGGAATTTT
TAAAAATAAATATAATCTTTCAGTAATCACTGCAATCTGGACATATGTCTGGCTCAATAT
TTTCGGCTATGAAGAATATTATGAACTTGGAATGTTGGGATATGCAGCAATTTTTGTGAT
TCTTGCACTAGTTCTTCTTTTCTGTCATTGGATGATGCCTGTTCGATGTTTCCTCATGTG
TTCAAAGCAAGAAGATGTTCGTATTGCTTCTCATGTGTGTGTTATCCCTACACAAAATAA
CGGATGGCCGGAATTAGTTAAACTTATGAGAACAACGGTTAGTCACAACTATTTAGAAAC
ATTTTCTTCAAATGAATTATTTCAGCGTGATAAACAAACAAAGTTATGGTTCGAATTTCA
AAGAGTTCACTATACTTGGGATGAAGAGAGCAGAGAATTTCAGACGAAAACTCTTGATAC
TGCGAAACCAATGGTTTTCTTTCAAAAATCACACGGATTCGAAGTTGAAGAGCATGTTAA
AGATGCTAAATATCTTCTCGGAGACAACAAAACTGAAATGATTGTTCCACAATTCTTGGA
AATGTTCATTGAAAGAGCTACAGCTCCATTCTTCGTCTTTCAAGTGTTCTGTGTTGGATT
GTGGTGTCTGGAAGATATGTGGTATTATTCACTTTTTACACTTTTCATGCTTATGACATT
CGAAGCAACACTCGTCAAACAGCAAATGAAGAATATGTCTGAAATCCGGAATATGGGAAA
TAAAACGTATATGATTAACGTGCTCCGTGGCAAGAAATGGCAAAAAATCAAGATTGAAGA
GTTAGTGGCCGGAGATATCGTTTCAATTGGAAGAGGTGCTGAAGAAGAATGTGTTCCATG
TGATCTTCTGCTTCTACGTGGACCCTGTATCGTTGATGAATCGATGTTAACTGGAGAAAG
TGTTCCACAAATGAAAGAACCAATTGAGGATGTTGAAAAAGATAAGATCTTTGATATTGA
AACAGACAGCAGATTACACGTTATCTTCGGAGGAACCAAGATTGTTCAGCACACAGCACC
AGGAAAAGCTGCAGAGGGAATGGTAAGATTTTGAAAATACAACGTTTTTAGAGTCACCAA
AAATGTATTTTATATTTCTTTAATTTTTGGACATTAGATATATTATTCCCAAATTGGTTA
AAAATACCGACTTTCGTGATCATACATTGTGAAAATTTCTTTTAAAAAGTTATGGCGGTT
CAAATTTTTGAGAAAAAAACTTATTTTCAGTTAAATCTGATATATTTTTTTTCAATTTTT
CAGCGTCGCAAATTAATTTTTTAAAAATTATCACTCTGTTGACTAAAAAGGCATTTCAAT
CAACGAAACAACGCGTGATAAATTGCCAAAATACTTCCTTCCGCGACTTGTACACAAAAT
TTGAGATTTTCGCTGGAAGTAATTTTTTTTCATCAAATCTTTGAACCAGGCCATTTTGAA
CCTAATGAAGCCTGTGACCAAATTTCTGTACTCCATCGTTAAGAAAATGAGAAAAAGGCA
TATTCTCAGCTAAATAATTTGCAGGTAAAATCACCGGATGGAAACTGCATCTGTTATGTA
ATTCGAACTGGATTCAACACTTCTCAAGGAAAACTCCTCCGTACTATCATGTTCGGAGTC
AAGAAAGCAACTGCTAACAATTTGGAAACCTTCTGTTTCATTCTTTTCCTTCTTATTTTC
GCAATTGCCGCTGCTGCATATCTTTGGATCAAAGGATCAGTTGACGAGACTCGGAGTAAA
TACAAATTGTTCCTTGAATGTACACTTATTCTCACTTCTGTTATCCCACCGGAGCTTCCA
ATCGAATTATCACTTGCTGTCAACTCATCATTGATGGCTCTTCAAAAATTGGGAATTTTT
TGTACAGAACCATTCCGAATTCCATTTGCCGGAAAAGTCGATATCTGTTGTTTTGACAAA
ACAGGAACATTGACAACTGACAATTTGGTTGTTGAAGGAGTTGCATTGAATAATCAAAAA
GAAGGAATGATCCGAAACGCAGAAGATCTTCCACATGAAAGTCTTCAAGTTCTAGCATCT
TGTCACAGTCTCGTTCGATTCGAAGAAGATCTCGTTGGAGATCCATTGGAAAAAGCATGT
CTTTCATGGTGTGGTTGGAATTTAACAAAAGGAGATGCTGTAATGCCGCCTAAAACAGCA
GCCAAGGGTATTTCTGGAATTAAAATCTTCCATCGTTATCACTTTTCATCGGCAATGAAG
AGAATGACAGTTGTTGCTGGATATCAATCACCTGGAACTTCTGATACGACATTCATTGTA
GCTGTCAAAGGTGCTCCAGAAGTGCTCAGAAATATGGTAAGAATTTTATATTTTGTCTCG
ACAGGACAAATCTTTGTCTCAAAAAAAAAATTGTCTGACTTATCATAAAATGGAAAGCCA
ACATTTTTGATTTTCCAGAAAACCATAAGAAACATATAATTTTCTCATTAAAAAAAAAAT
GAAAAATGGCCAAAATTTTGAGCTAATTTTTGAAAAATCGAATGTTTGTTATCGAAAAAT
TGGAGAAACAGAAAATCAAAAATTTTGGTTTTTTAATTCTTAATAATAAAAAACGAACAA
TTTATATTTTTTCGATTTTCCGGAGAAAATTATCCATACAATTCAATTTTTATCCTATTT
TTATTTATGTTGACGAAAAATGAGAAAAAAACATGAGAAAACACAATTTGTTTCATAAAA
TAAGAAAAATAACCAAGATGGTAAGCTATTTTTGGAAAGTCAACAGAACGAAGAACGAAA
ATGTTCGATTTTTAAAAAAAAATCATCGTTGTTGAATTTGTATCGATTATTTCTCAAATT
TTGTTCAAATTTATCTGTTTTTATAGCTTTATTTTAGTTATTATCATTTTTATTAGAAAA
CTATTAAAATCGATGAAAATTCCAAAGCAATGCGTTTTAAATTACAGTTTAAAGGCGCGT
ACTAATTTGCATTTAGTATAGATTTATAGAAAACTTTCACATCTGCGTAATAGTCATTTT
CTAAATTTCTATTTACAGTACGCCGACCTTCCATCTGATTACGACGAAACGTATACTCGT
CTGACTCGTCAAGGATCTCGTGTTCTTGCTATGGGAATACGTAAACTTGGAGAAACTCGA
GTTGGAGAACTTCGCGATAAGAAACGAGAGAATTTCGAAAATGATCTCGCATTTGCTGGA
TTTGTCGTCATATCGTGCCCACTGAAGAGTGATACTAAAACAATGATTCGTGAAATTATG
GATAGTTCTCATGTAGTTGCAATGATTACTGGAGATAACCCATTAACAGCTTGTCATGTA
TCAAAAGTTCTTAAATTCACCAAAAAGTCATTGCCGACTTTAGTTCTTGATGAACCTGCC
GATGGAGTTGACTGGATGTGGAAATCTGTTGATGGAACTATCGAATTGCCGTTGAAACCA
GAAACAAAAAATAAAATGGAGAGAAAAGCGTTCTTCAATTCTCACGAATTCTGTCTGACC
GGTTCAGCTTTCCATCACTTGGTGCACAATGAGCACACTTTCCTACGAGAGCTTATTCTA
CATGTTAAAGTATTCGCAAGAATGGCTCCAAAACAAAAAGAACGAATTATCAACGAGTTA
AAATCATTAGGAAAAGTTACTCTTATGTGTGGAGATGGTACAAATGATGTCGGAGCTTTG
AAGCATGCTAACGTTGGAGTTGCTCTTCTAACAAACCCTTATGATGCAGAGAAGGCCGCT
GAAAAAGAAAAAGAGAAAAAAGCAAAAATCGAAGAAGCTCGTTCACTCGTTCGCTCAGGA
GCTCAATTACCACAACGACCAGGTGCCCCAGGAGCACCTCCAGCGGCTAACGCAGCTCGT
CGTGATGCTCCTCCTGGAGCCCGCGCGAGAGCTCCCCTACCACCAATGGCTAATGCTGCT
CAAGCCCGACTAGATAATCTAATGAAAGAGTTGGAAGAAGAGGAAAAAGCTCAAGTGATC
AAGTTGGGTGATGCCTCAATTGCTGCGCCATTCACCAGTAAATATACATCGATTGCATCC
AGTGAGTTTTTCAAACAATTTTACCCAGATTTTTGCGCTAAAACTACAGAACCTATGGTC
TCGACATGACAACTTTTAAAATACAAACGGGCGCGCGCCTTTAAAAAGTACTGTAGATTC
AAAACTCTTGTTGTTGTAGAGTTTTTTAATGAATAATTTTTTAACGAAAAACTATGAAAA
CTCCGCAGCAAAAAATGTTTAAAACTACAGTACTCCTCAAAGGCGCACACGTTTTTACAT
TTGCCAAAAATTTGTCGTATCGAGACCGGGTACCGTATTTATTACTTTTAGTGCAAAATG
TTGTGCCTCTGTATAATATCATTCACTTCTCAATTTTTTTTCAGTTTGTCACGTCATCAA
ACAAGGTCGTTGTACTCTTGTTACAACTCTTCAAATGTTCAAAATTCTCGCTCTCAATGC
TCTTGTTTCTGCTTATTCACTTTCTGCACTTTATCTGGATGGCGTTAAATTCAGTGATAC
CCAGGCAACTATTCAAGGACTTCTTCTTGCAGCATGCTTCTTGTTCATTTCAAAATCAAA
GGTTTTTTATCTAGCTTATTGTTAATTTTTATGTTAAAATTCCAGCCTCTGAAAACATTA
TCTCGTCAACGACCAATGGCGAATATTTTCAATGCCTATACTCTTCTGACTGTCACTCTT
CAGTTTATTGTACACTTCTCTTGTCTCCTTTACATTGTCGGACTCGCACATGAAGCCAAT
ACAGAGTAAGTTTTAAAGAAAACCTGAAAATGTGCAGAAAATTGTATTTTGCTGTCCAGC
CCTAAACCATATTCTTTATAAACGCGAGTTGTATCTCTCCGGCGGCATTGCCGTGTGGTC
GAATGGTTAACGTGTGCGCTTGTCGCCCGTTAGTCGCTGGTTCGTGCCCGCGCTGTAGAG
TTTATGGCGGATAGGAACCAGGTCATGTTTGTACGTGATTTGGGCCGACATCCCCGCCGA
AATAGTCCTGCGAAGATCTAAGGTCGCTTCTGGATGGATTTGCCACCGGGTGCACACCAT
CTTCGTGCACAATTTTGAATATTCAACTTTTTTTTTCAGAAAAGCTCCTGTCGATTTGGA
AGCAAAATTCACGCCAAATATTTTGAACACTACGGTTTATATAATTTCAATGGCTCTTCA
AGTTTGCACATTTGCTGTCAACTACAGAGGACGACCGTTCATGGAATCTTTATTCGAGAA
TAAGGCCATGCTTTACAGTATTATGTTCTCAGGAGGAGCAGTTTTCACTCTTGCCAGTGG
ACAAGCTACGGATCTCATGATTCAATTTGAACTAGTTGTTCTACCAGAAGCTGTAAGTTT
TATCCTATAAATAGTGTTCCTTATTCATACTTCTCTCATTTCAGCTACGAAATGCGTTGC
TAATGTGTGTCACAGCGGATCTTGTTATCTGTTATATCATCGATCGTGGTCTGAATTTCC
TGCTGGGAGATATGTTCTAAATTACTCGTTTTTCTTATTATCCTTCTTCCTTGACATTCC
CTATCAACATCTTTTTTCTGCCATCCTGTTGTTTAATTTATTTTTTCGGTTTTATCTTCA
CTTAGAACCAAAGCTATCGCATGATCTAAGATCAGAAATAGTCATTTCATTGTCGCTGTT
TCAGAGCATAATGTTTCTGTGATATATACATTTCTGTTGAAATCTTGCAGATTCATTTAC
AATGTATTTATTTGAGTCTTTTTTTAGTAATAAAATTATCATCATCATTCAAACATTCAA
CAAATTTGTAACGAGTATAAAATTTACATCAGAAATTGTTTCTATCGAGCTTTGCTGACT
CGCAAAGCTAATCCAGCGTAACCAATAGTGTAGAAGATCAAAATGAATGCAGACATGATG
AAGAGATCCGGATAAAACATTTCAGCGCGGAATGACAATTGGGAGAGTACGGAATCACGT
TTCTGAAAAATTAAATTAAAATTAACAGCATTTCAAACTGTTTCTAACCTCATCAGTCCA
AATAGTTGTATTCTGTTCATTGACACTGCTCCACTGATTGATTGCAAAAGCCTCAAATCC
ATATCTGAACCACGAGAGATACTGTATCCACGAGATGTATGATGGTAGTGCACCAACATT
AGCGTAAAGACCTCCAGTCAATGATAGAAGTGTGAGCATTGGGCCAGCAGTTGACATTGC
GATCTGAAAATTCTATGATTTATGAAGTTAATTGAAGTTTTTTACAAACCGGTAAAGACG
GCGAAATGCAAGAAATCATGATTCCACAAGCTGAAGAAGATTGCTCAATGAGGAAGGCGA
TGAGGCATGCGTATAGAACCTGGAATTCCAATTTTTCAAAAATATTATGGAGACGCAGAA
TAATGCGTATTTCGAAGTTTGGTCCCATTAGGTATTTGGCGGCAAATCCATGGATTCGAA
AGTGTTTTGTATTGTTTTGCCGCCAATTAAAAACGCATTTTTCTGGGTCCCCATAATACA
GTATTCTCAATATTATGAAAGGAAAATATGACATCTCTGAACTTCAAGTTTTGACTTTTT
TTCCTTCAAAAATTACCTGTGTAATAGAACTCGAGAATCCGACCATCCAATATGATACAA
GAAGCATAATAAGTCCATCGGCAGTAAATAGTGGAAGATATGAGAGACATCGAGCCACAT
AATATGAGAAAACAGAATAAAGACCATCGTGATATTCTCTGGAGACTAATGGAAAGTCGG
CTGGCAAAAAGTTCAAAATTCCGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1104, 1163..1416, 1465..2181, 2664..3455, 4158..5160, 5504..5700, 5745..5884, 6219..6471, 6524..6885
1020..1104, 1163..1416, 1465..2181, 2664..3455, 4158..5160, 5504..5700, 5745..5884, 6219..6471, 6524..6616
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved