Caenorhabditis_elegans Locus cng-3
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans cng-3
Caenorhabditis_elegans
cng-3
IV
F38E11.14
4261..4331
5438
CCACATTGACCAGTTTTTTGGAGTTCTATATACAAGTTTCTTAAGATCTTCATAGAACT
AGTGAACTCTGAAAATTCTTGCAGATCAATTTAAATAGTCTGAAAAACATGAGACAATTG
TCCAGTGGTATGCGAAAAAAATAACACTCATTTATTAACAACACTTTATTGACACGAGAT
CTTCCTGCGAACGCCAGAAGATTCCCACAGACAACGGGAGTTTGAGTAAATTTAAAACTG
ATGTTTCTTCTACAATCTCCTCCTTATATAGCCATCTGATATGACCTTTCACGTAAAGGT
CGCAAAGGTTGTTTCACGCTTTATTGATAGTTCATTTGTATGTATTCTTTCGATCATAAA
GTTCCTTTGTTATTGTAGAAGTGTGGCCATGTTGAAGTTGCTTGCAGATTAGTTTCATGA
GTTGTGTTGCATGGTGGAGTGTGCCGAGTGTCATAAGCCGTTGATATAGTTTTTTAAAAA
TATTTTTGACAGTAGTTAGCCGAGAACAGGAGAGGTTCATCCTATCCGTATTTGCGCCAA
CAATGAAAGCATTGTGATGATTTATTAAGAAAAAAGCAAATTTAGATACAGTTTTTGATA
TATCCGTTTTGTTCAATATGTTTGCCAATTTACATATGAACATAAATCGTAAATAAATAT
TTTTTCTTTCCTACTAACATAATCAAAATGATTCTATTCATATTTTTATTTTCTTCATAT
CAAATCCTTTTCACTAATACCTTTTCAATCCATGGCTCAACTCATCGGCTCATTTCTCTC
ATTTCTCCACATGCACCTGCGTCACCAAATATAATCACTCGTGTATTTTCCAAAATCATC
TTCGTACCTATTTCCTTTTTCAACCCAATAGTTGAGTGTTTTCTTGATAACCTTCATTAA
TTTTAAGAAGACTATCTAATTTTAGGAAGAATATATAGAAAATATACGGATTCCAATGGC
TTCTTTAATCTAAATAAGGCTTTATTCTTGGGAGGGAGAAAATGAGCACACATTCGGCAC
AGAAGCTGCCTAATTTGCATGAGAGAAAGAGACGAATGTCCAAGAAACCAGATGATGATG
ATTTGATTCCTCAACATTTTGAATATGAAAATCAATATGAGAAATGGAGAGCTGCAAATC
CGAGAATCGAGTAAGTTGTTTTTTTTAATGTTATCAGAAAGTTCTTAAAGCGCTATATTT
TAAAAGTTACATATGTCAAATTTTTAACATTTTTGTTCATTCGTGCGGTAACAAATTTGG
TTTAAAAAACAAATAATTCTTATTAGGTTTCGAAGATATAATAACATTTTTTATTCCTTC
AAACAAAACACTTTTTAGATATGACTTTTCGGTAGATGAATCTGGATACATTTACTGGAT
TTGGACATTTTTTGTTGTATGTGGATGTTTATACAATATAATTGTACTCTCTGTATTGGC
TTTCGAAAATATAAGATACGCATACATTGAGAAAATTCTTCCCATCAATATTGCATTTGA
TACCGTTTTTCTGTTTGACATCATACTTCGATCTATGTTGTGTGAGTTTTTAACCTTTTT
TTAATTTTAAATTTTATTTTTAATTTATCCATTTTGTAAATGCAGATTGGATAATCTAAA
ATGGTTTTGGAAAGTTTAGATTTTTTAAACCAAAATATTTTCAGCATTCTACGAAGACGG
AGTTTTGATCACCAGCTTTTCAGAAACTTGGAGACATTATGTTCACAGGTACTTCTTATC
TTTCTATGATTTTAACGAGGTTGATCAAAGAAATTACCAGTTATCGTGCATTAATTTCTA
TTGAGTGGCTACTATAATTACGTTTGAAATCTGATAACATGTAGCTACATATAAACTAAC
AATTTTAATTTCAGTTTCTACTTTGCAATTGACCTATTAGCAATCTTCCCATTCGACTAT
CTGCTTATTCGAAAAACTTCGGCCGCTTTCTGCAGATTGAATCGATTTTTAAAGATTTAT
CGAATTGCTAACTTTATAGCACAGTCCTATGGAAAGTTGACTCAGGTTTTCTTAATCACT
AAACAGAACAGTAGTTCAGAAATGAATTCAGGTTACGATATCACTCTCCAAAATATTTAC
TGCTTGTTTTTTGTTGTTCCATGTGAATGCTTGCGTATTTTATATAATTTCTGTGAACAG
TGACACTTCGTCGTGGGATGGTGAGTTATTTAAACAAAACATTTTTCTTTATTTTTAAAA
TAAAATCCCTTTTTAGGAGTAAATGCAACATTTGACGATGATGAATATCTTCCATGGCCG
TATACACCAGAGAAAATTACAGGTACAAATCAGGGCTGCAATAAGCAATTTTCTAATTAA
TATATCTGTCAAAAACTTATTTCCAAATCTTTTGGATACTTTTGGAAATTTTATTCCTAT
AGTGAAGAATTCAACCAAACATACAATTAGGCAAATCAGATATTAGCAAATTAAAAAAAA
TCAATATCCAAATTTCAAGAATTCATTTATCTCACGATCTCATTCCCGTAAATTCTCCAT
TTTCAGATGCTTACTTTGTTGGCTGTGACGGCCGAACAGATTGTTACAATCCCTACTTTT
ATTACGATGAAGCGAGGGAGGATCATCTTGTGGAACTGTATCACTTTTGGAGAACGGATA
ACAGGTAAACAAATAACTAGTGTGACTTTGACAAGAGGTCAAGCTAGCTATCTTGGAAAA
ATCTCAAAACTTTCAGAACCCATATCTACAACTTCTCCCAATTTACAAAAGAGTATACAT
TGTCAATGTATTGGTCAGCAATGACAATGACCACATTAGGAGAACAACCTGCACCGAATA
CTTCACTACAAAATGCATTTGAAATTGTTAATACTTTGGCAGGACTTTTACTTTTTGCCG
TTATAATGGGAAGTATCGGAGATCTGGTAGCAAATGCAAATGCTGTTAAAACATTTTGGC
AAACATTAATGGATGGTCTGAAACAATATATGACCTATAGGTTTGTAGTTTAAAATATTT
AAATACAACTTTGGAACTCTTATGTTAGCTATACAATATAAATCCGGTTTGAAAATTGTT
TACAGAAATCTCAACGAGCGATTGCAAACAAAAGTATTGAAGTATTGTGAATATGAAATG
GCAGAAGAGACAATTATGAAAGAACATGAAGTAAGAGATGAACTTCCAGCTAAACTATAC
GGGCATGTTACCACTTCAATTATTGGAGCATCGTTAGTGAGGTCTCCATTATTTAGGGTA
AGAAATTTTCGGAAAAATCTTTAATGATACAAATCAGAAGTAATAGTAAAAACATTTTCT
AATCAACGATGTATGGAATTTACAACCAAAGTTTTCCGTTTTCAAAAATGTGGTTTACCG
TATTTCCTCCAATAGTTACTTTGAAACGTTGTGAAAAGTCAAATCCAATCAGAGAATTGA
AACAAAAACAAAGAAAAAACAAGGCATAATCTTCAAAAAATGTGTTGTTCATACATTTTT
CAGGCGTCTGAACGAAGTTTTCTCAATGATATCTCTCAACTTTTGGAGCCTCATTACTTT
TGTCCTGGAGACGTTGTAATTGAAAAAGGACAATTATGCAGTGTGAGCTACTGGGATTTG
TAGACTAGATATGAATTTAACCTATTTTTAGTCAATGTTTATAATTGTTTGTGGACAAAT
GGTGGAAATCACTGAAGACAACGAAATTGATCATTTCGAAGGAGAAATTCTCGGAGATGT
TAATCTAATATGGTTCAATAATCATTTGAATCATAATCGTCATCAACATAATGTGATATC
AAGTGCATTTTCACAGATTCATATGCTCAGTAGAGATGATTTTTTCAAGGTTCTGAGCTC
ATATGATCCTAAATTGAAAAGAAGATTGTGTGATGTTGGTGAGTTAAAATTGTATTTGTA
CAAAAATATATGAGTTTTGTATAAAGGTAGATACTCTATATGGCATTGCAACTTTAACTC
CTTTCAATCCACCTAATCAATCTTTCAGCTTTCTATTTGCAACGTCAACGTGGAGAGCTA
GATGACAAAAAACGTTGTCTATCGGAAAATGAGGATATAGAATCGAACCTAAAACGACTA
GCAATTGATACTCTTGAACTTCATGACAAGATGACGGAAATGGAAGAAGAGTTTTGGGTG
AGTGCAGACCAGATACTCTTGTAGACACTCTTTAGAAGAGATTGGTTATGCCCGCATGGC
GCAGGTGGTAAAAGTGTGGCCTGGCAAACAACGGGATGCAGTTCATTTCCACTCGCCTTC
GGGTCGATGATTAGATTATTCTACTGTTCACGTACCGACTGTTCAGTGGTGGATAAACCT
TCTATGAGACTTTTTGTTTTATTTTTCAGGATTTTTCTGCAACTGCAAAAAGAAAACTTT
TCGAGAGTGAGATGGTCGTTTGTGACCTTTTGAATAACAGTCAAAGGAGGAGTCGATAAG
TATTGGTGTCAAGAAGGGGGTAGAAAAAAACAAAACGAAAAGAAGACCGATCATCATTGA
ACCGGTTGTGTCGCAATCGAGAGAAGAAGACTTTGGGAGGGCTACGCATTTTTCTTCATT
GCTGATTTTTTCGCGGTCATTTTCATTTTCATTTTTCTCTTTGCTGTTCTCTGTCTGTTT
GTCGAAGTGACAGGTGGTGTGCTTCCAAGTTTTTTGCCATTTCAATTCTAACAATATGTT
GTACCACGTGGAAATGTTCACGATTATTCTGTTATTTGGATTCAGCTTGGCGGATTACTG
TGGATCCGATCAAGTACCATATGGAATGGAAGTTCATCACAGTGGAGTGGTTCGATTAAT
GTGTTCAAAACCTAATTGCTACGACAAAAATTATTCGGTAAGTCAATAGAGAAATTCGCA
TGGAAAATCCAAAAAAAAATCAACTTATAGGACTGTCCAGAACGTGCTGAAAGTCGGCAT
GGATGTCAGAAGTCGAATCAATGGGTTGGAGGATTTGAGAAAAATATTGAAGGAGATTTA
TATACAATGTGCTGCGAATTTGAAGGATTAGAGAAATATGCTAAAGTTCGATATTCAGAT
GTATGTTTGATTCAAAATGTATATTTAATTTTAAAATTGGGGTGGCATACTTTCAGTGAA
AAAATTATTCTGGTTTTTTCCGTAAAATACTGTATTAAGCAGCTTTAAAAATAAATTCAA
GATTAGGCTATTCATTATAGATTTATAAATTATGTGCAAAAAGCATTAATTTTCCAATAA
AAAAATAAATAGGATATAACCAAACTTGGAATTATTACCCTGTATGAAAAATTATACCTA
GCCCTGTCTGAAAGGAAATTTATATTTTCAGGTCCGTATTCGACGAGGTGAATTTTTCGA
AGGAGAAGAAAAAGAAAATGATGATGGAGATGTGGTAAAATTTGATGTAATAAAAGATAT
TCGAATGCATAAGGATGATGAAGGGTTCGTTTGTTCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1149, 1338..1540, 1664..1727, 1874..2024, 2071..2179, 2236..2301, 2526..2643, 2716..2979, 3065..3236, 3483..3581, 3631..3877, 3988..4136, 4349..4438
1001..1149, 1338..1540, 1664..1727, 1874..2024, 2071..2179, 2236..2301, 2526..2643, 2716..2979, 3065..3236, 3483..3581, 3631..3877, 3988..4136, 4349..4435
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved