Caenorhabditis_elegans Locus D1046.1
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans D1046.1
Caenorhabditis_elegans
D1046.1
IV
D1046.6
1932..2060
5942
TCGCCAGATCCAAATATGTAGGAACACTAAAATATTTAGAGACTGAATATGTTTCTTTT
TTATAAAAGTCAATACTTTTTATCACATCCATAACTTGGACAAACGATATTGCTCACAGA
CGATCCTCCAACAGCCATTTCGTCAACACGCGCACACGGGCTATTATCTTTTTTTAAATG
GCTCGTTAATCCTGTCTTTGTGATAAACTCCATTCCACAATTTTCACAAGAATGCAACGA
TTTTCGCTTCGGCTGAAAATTAACTTGATTTTCAAATTTAGATAATTGAAATATACATTT
GGTCTCCCGAGTCGTTTTTGCTGTTTCATCATTTCACATTGCTGCTTCGTGAAGCCATGA
TGATCAAATAAATGATTGTAAAATCGTTTATTTGTGAGATCTTCTTTACAGAAATGACAC
ACCGAACTGCAAAATTTTCAAATCTTTGCGGATTCGGCTAATTGATTTACTTACTGGTCT
TGATTAGCAGCATATATATTTTCAGGTGTAAAATAAGTTCCTTCCATAACATAACATGGC
ACATCTGTCTGTTCTTGAACTTGAACCATAGTACCCGGACCATCGTTGTACTCCTCCTGA
CAGTAAATTATTTGCTGAAAATAAATATTTAATTTGAAATGGGAGAATGAGTTACCTCTT
CTGCGACTTCAAGTTCTTCATAAGCTTCATGATTTACTATATCGTTTTGCTTATATCCGT
CATTCATGATGAAAACTGTAAAAGCTTAACTTCAAAAATATTTTTAAAAAAATGTTTTTC
AAAATCAATTTTTTTTTTCGTAAATCGACATTTGCAAACGACACTCCGTTGAACAGACAC
GCTTGTTGTTTAGCGTGCACGCCCCACCCATGTTGCGTTAATAAATATTTTTTGATTTTA
TCGATTAATTAAATAATTGTTCACTTATTCTGTTAGAAGACAATTGAATTTTGACTTTTT
AATTTTCTCTCTTAAAATTCATGTAACCGTTGTTTGTTTGAGGATTGATGGCTGAATTGG
ACGAAGCAGCGTTGTTAGGTGACGGTAACGAACAACATGATGGTCCCATAGACGAGAATG
CGTTGCTGGATGGGTAAATACTTTAATGAAAAAAGAAAATGCTAAAAATTTATTTTTTGA
TCCAGAAAAGAGCTCAAGGAAGAAGATATTGACGATCTGTACGATGAAGCGATTGCACCC
ACAAATTCAGTGAGTTTTCTAATGAATTCTTATTAAATCCTTATAATTCTTTATTTTAGA
CGGAATCAGCAAAACCTGTTTCACCAACAATCACCACTGTGACTGCTCCAACTGCTGGAA
TTGGTGCAAAACCAGCGACGTCTTCGGAAGGAAGAAAATATTGCTGCTACGTGGGAAACC
TTCTCTGGTATACTACAGATGCTGATTTATTGGTAAGTGACTGTAAAACTGAATGTCTTC
AATAAATTTTGTCCAGAAAGCTCTTCAATCCACCGGCCTTGCACGATCTCAATTCGCTGA
CATGAAGTTTTTCGAGAACAGAACGAATGGACAAAGCAAGGGATATGCTTTATTGGTTTT
GAATTCTGATGCTGGTTAGTAGAAACTAACAAGATATTTCTAAAAACTTTATTTCATTGC
AGCGGTAAAACAAACTATGGAGATTCTCCCAACTAAAACTATCCATGGCCAAAGTCCAAC
TGTTTTGTCGTACAATAAAACGAATCAGGCAAAGCTGGAAGATGCGCAAGCAAAAAATCA
GACCCGTCCAGACGTCAAGAAAAAGGTAAAAAAAGAGAATATAACACTATCGTTGAAATT
AGTGCTGTGACTCTCTGCTACTCCACGGCGCACCGATATAAACGTTTTCCACTTGGTACT
TGTGGTCGTCGAGGGAAGCGCAGTCGGTTGCGCAGTTGGCTGTCAGTCAGCAGTCCGCGT
GATCGATTCCCGCCCGCGCCTAGAAACTCAGCGGTGTTTTGTCTTTATGATCATGAGCTG
GTAGCAGGTGCAATATTGATTCGGAGTCTTACCGGCGTCCACCTTCTGAAGGGTGTGCGT
TAAAAGTTCATCCGAACAATTTATCACTTTTTAATAAAGTTTTCGAAAAGTTATACTAAT
TATGAACATTTTTAATTTGGCAGGGTTTCGAAGAAGGATGTGTCAATATGGGAACTATTC
GTATTGGAGCTGGAGGGCAAACTGGTCGAACTGGAACAAGTGTCTCTGGTAGATCTGGAC
CTCCACCTCTCATGATGCAGCAAGTTCGACCAACTCCTTTGATGAGCCAACCTACATCTC
TGCCAAGCAATCTAAATCAAGCTCCTCAAATGCGATTACAAATCAACGGACAACAAGTTC
CATTAATGAACCGTGCTCCTGTGCCACAACAAACAATGTTAGGAAATGGACCATTAGGTG
GAATGAATCAACAAATTCAACAACAACCTCAAATGATGATGGGACAACAAGTTCGACCAA
TGATGCAAACATCAATGGGAATACAACCAATGATGGGAATGAATGCACCACCTCCAATGA
ATAATCAATTCCAGAATAGGTAATCGTATAATAATCCTCTATCATTCTTTTTCATTTCCA
AATAGTTCTAGACCACCACAACTTGGTTCAATGGGTGTTCAGCCACTTATGCAAATGAAT
ACAGCTATGCGTCCTCCTATCAACGGTCTTCCACCAGTCCATGTCAATCCACAGGTAATG
GTTTTTTGAAAACTAAAAATAATTTTGAATGATAATTTTATTATTTTCAGATGTTCCCCG
GACTTCAAGGAACAGTTTTATCTGACGCTGAGTTCGAAGATGTAATGACAAGAAATCAAA
CTGTATCATCGTCAGCTATAGCTCGAGCAATAACTGATGCATCTGTTGGAGATATTAAAG
GAGCATCTGAGACTATATTGACAGCAATTCAATTGATTAAAAACAGTCGAATTGGACATG
ATGAAAGATGCAGACAATTGGTTTATGGATTGGAAGTACGTTTAAAAAAAATCCTTCTTG
AGCAAAACTCTAATTTCCATTGAAGTTTAAATGATAGAAAATGGACCTTAATGACCGTTA
AAAAATGTTCGATTTTTTATGATTTTTCGATAAAAAACTCGATAAAAAATTTTTCATCGT
TTGTCAATTTATTAGTTATGTCTCTGTAAGAAAAACTTAATTGATAAGAAATAAATTTAC
TGAAACAAAACTTTTTTGCTAACATATCAGTGATTTAAAATTTAATTTATAAATCTAAAA
AAAACGGTGTTTCAAATCAAATATCAAAGAAAAAATCAAGAAAAACCGATGAATCTAAAC
ATTTATGCAAATTTGAAAAAAAAAACCATCAAAAATTCAGAAATTTAATTAAGTTTTTAA
ACAGTTATCTCAATATGGTCATTATGGCTTTTTTCTTTCATTTGATACAAAATTTCACAA
CGACCATACTCCACCTTTACAGAAATACAAAGTAAATCGCAATTTTTTTTCATAATTATA
TATTTTCCAGCACACACTCAAAGGCCTTGAATCAAAAGGATATTCGTCTCGTTCAAAATC
ACATCGTGATCGTTCAAGAAGTCGCGAAAGAGATCGCAAAAGAAGAAGACGCAGTCGCAC
TCGCTCACGGTTCGTTTTGGAGCAACAATTTTTTTTGAAAAAATATTTTTTTAGCTCATA
CTCGCGGTCACCATCTCCACGCCGTCGTCGTTATTAAATAACACGACTTTCTTCAAATTC
AAGATTATTTCTATTTTACTCTTCAATTTTCACTTTTTCAACAATTTGGTAATGCCGATG
CTTGCTTTTGCACAAAACAATTTTCAATTTTTCAGATCCAAAAATGTTATATAATCTCTA
AATTTCATTCTCAATGTTCACTGGTCGATTTCGATTTATTCTCACTTGCATACGGGATCT
GCTCACTTGTACTCTAAAATTGTAAGTTTTTGACTTTTTAATTGATTTTCAGATTTGTTC
TTTCAATTACCTTTCATTGTTCTATTTAAAATCGTTTTGAATGTAACTCCTCAAGTATTG
GGTCATTTCGAAATTTCAGTTGTATCGGGAGTATTTCGAAAAAAGTATGCTATGAAATTT
GTAACATTTTGCTAGTATTTATTGAGAGCACATTAAAATTGTAATATTTTCATTTAAAAT
AAGCTTGGGTTTGGGTAAGCATTGATTCTATAATGTGAAATTGATATTTTTTTTGATTGA
AATAGATTTTTAATGGTGTTAGTTGTTTTTATCATTTAAGCTTCCTATGTGTTTAATTCT
ATATTTTGTCCTTTAAATGTAGTTTTGTTTATTCACTTACGTCTTGAAATTTGATAGGTT
TCAGCTGAAATGATAATTTGAAAATTATTTGTTAATCCTTTTTGTCAAAAAATTTAAAAG
TTTTAGGCATTAATTGTAATGTCAGTGATAATGTGAAGAAATAAGCATAGCTGATATTTT
CTATTGTATTTTTTTATCTCATTTCAATTGTATTTTCCAACAGGTCCAGCAGCATCCACG
TGGCATCGAGTTCAAATCGGAATCGTCAAAAAAAATCCCCGCAAAATCCTCTCAACAGAA
ATTTTTTCTTGATCTGAAATTCACATTTTGTTTTCTAAAATTTCCAAACATTTTAAATGA
TTAATTGTAATTCGAGCACATTCGATGAAAATTCATTGAATTTGTTGACAATTGTGTTGT
GAATCCCGTTTCAATTCTTCAATAAGAATTTAATTGGTAAGCCAATATTTTTTATTGTAT
TTATTCACTTATCCAAAATCCCTGGTCTCATTTTCGTGAGTGCTTCCTTTTATTTTTCCT
GATCCTCGCATTTACATGGTTGAAATCATTGCTTTCAGAATGTGTTTCAAGCAAAATAAA
AAAAACTTATGTTCATATTTCAGAATACTGGCTATCTTCCAACTCAACAATGATTCGTGT
ACACATTTTCTCATCAGTGCTCACTATTGGATTATCTTTTATAAACGTTGTCTTTAAAAG
TTTTGTTTAATTTAATAAATTGCAAATAAGAAATGTGTTTTCATTGCTTCCTTTCCCATG
AAGTCGAATTTGTCGACTGATGTAGTACCTCTAGAATGAATTGGATATTTTAAATATGGA
GTAATTTAGGATGCCATCAGAAGAAGGATCGGTGGTACGATGGCTCGTGTGTGGGGCGAC
AGCTGGTTTAGCAGTTGATATTGGATTATATCCATTGGATACAATTAAATCAAGAATGCA
ATCTAAACAAGGATTCATTGCAGCTGGAGGTTTTAAAGATATTTATAGGTGAATACTTGG
AAAAAATGGATATAATTAGTTGGTTTTCGGACATTTGAGAGCTTAACCCAAAATTAAATT
CAAAAATTCAGATAAATGAGGACGCAGAAAATAAACTTTCGAAATGGAAACAAAACGCTC
CGCCCCCGAACCTAGGGTCTCGTTAGGTATTTGGCGGCAAATCTGTAAATCCAAACGTTT
TAAAGTAGTTTTGCCAATTTCACCAATTTTCAAGTAATTTTCTTTTTTTAATCAATTTTG
GCATAAACCTCATTAAACATATCTGGAAACATAACCAAAAAGCTTTTAAAAGTCAAAAAT
CGGTGAAACTCATCGAAAACGTTTGATTCACGGTTTTGCCGCCGAATACCTAACGAGACC
CATAGCTCGTGGCCGGAGCGCCGATTTCAAAAGCGGCATTTTTCTGAGTTTTCTGCATAA
TAGCTGTAGATTAGATTCTCTATTTCAGGGGAATGATCTCAGTATTAGTTGGCTCAGCAC
CCGGAGCTGCCATTTTCTTCCTCACTTACAAATACATTAATGGACAAATGAAACAAGTAA
TTGAAGAAAGAAATGCTCTTGTGGATGCTGTTTCTGCAAGTTTGGCTGAAATTGCAGCAT
GTGCTGTAAGAGTACCAACAGAGCTTTGTAAGCAAAGAGGACAAGTTAATAAAAATGAAC
GAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1092, 1145..1208, 1259..1411, 1456..1573, 1622..1764, 2123..2538, 2591..2693, 2750..2974, 3490..3608, 3654..3767, 3815..3920, 4883..4942
1007..1092, 1145..1208, 1259..1411, 1456..1573, 1622..1764, 2123..2538, 2591..2693, 2750..2974, 3490..3608, 3654..3693
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved